ID: 1123563510

View in Genome Browser
Species Human (GRCh38)
Location 15:21516648-21516670
Sequence TAGGGTGGGTAGGAAGCTTC GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1123563493_1123563510 23 Left 1123563493 15:21516602-21516624 CCGGGAAGAGGGAGTAGGAGCGC No data
Right 1123563510 15:21516648-21516670 TAGGGTGGGTAGGAAGCTTCGGG No data
1123563501_1123563510 -7 Left 1123563501 15:21516632-21516654 CCTGCCCGGCCAGGCCTAGGGTG No data
Right 1123563510 15:21516648-21516670 TAGGGTGGGTAGGAAGCTTCGGG No data
1123563491_1123563510 30 Left 1123563491 15:21516595-21516617 CCAGGGGCCGGGAAGAGGGAGTA No data
Right 1123563510 15:21516648-21516670 TAGGGTGGGTAGGAAGCTTCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1123563510 Original CRISPR TAGGGTGGGTAGGAAGCTTC GGG Intergenic
No off target data available for this crispr