ID: 1123564685

View in Genome Browser
Species Human (GRCh38)
Location 15:21532422-21532444
Sequence CTCAATCCTGGGACCAGTGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1123564685_1123564693 10 Left 1123564685 15:21532422-21532444 CCCCCACTGGTCCCAGGATTGAG No data
Right 1123564693 15:21532455-21532477 ACAGAGCCTCAGACTCTGGAAGG No data
1123564685_1123564692 6 Left 1123564685 15:21532422-21532444 CCCCCACTGGTCCCAGGATTGAG No data
Right 1123564692 15:21532451-21532473 AGAGACAGAGCCTCAGACTCTGG No data
1123564685_1123564697 29 Left 1123564685 15:21532422-21532444 CCCCCACTGGTCCCAGGATTGAG No data
Right 1123564697 15:21532474-21532496 AAGGGATAAGTAATGAGGAATGG No data
1123564685_1123564694 11 Left 1123564685 15:21532422-21532444 CCCCCACTGGTCCCAGGATTGAG No data
Right 1123564694 15:21532456-21532478 CAGAGCCTCAGACTCTGGAAGGG No data
1123564685_1123564698 30 Left 1123564685 15:21532422-21532444 CCCCCACTGGTCCCAGGATTGAG No data
Right 1123564698 15:21532475-21532497 AGGGATAAGTAATGAGGAATGGG No data
1123564685_1123564696 24 Left 1123564685 15:21532422-21532444 CCCCCACTGGTCCCAGGATTGAG No data
Right 1123564696 15:21532469-21532491 TCTGGAAGGGATAAGTAATGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1123564685 Original CRISPR CTCAATCCTGGGACCAGTGG GGG (reversed) Intergenic
No off target data available for this crispr