ID: 1123578369

View in Genome Browser
Species Human (GRCh38)
Location 15:21695059-21695081
Sequence GAGGGAAATCAGCAGGAGGT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1123578365_1123578369 -5 Left 1123578365 15:21695041-21695063 CCGAGCAGGAGCTGGGCTGAGGG No data
Right 1123578369 15:21695059-21695081 GAGGGAAATCAGCAGGAGGTAGG No data
1123578360_1123578369 -1 Left 1123578360 15:21695037-21695059 CCCCCCGAGCAGGAGCTGGGCTG No data
Right 1123578369 15:21695059-21695081 GAGGGAAATCAGCAGGAGGTAGG No data
1123578361_1123578369 -2 Left 1123578361 15:21695038-21695060 CCCCCGAGCAGGAGCTGGGCTGA No data
Right 1123578369 15:21695059-21695081 GAGGGAAATCAGCAGGAGGTAGG No data
1123578356_1123578369 21 Left 1123578356 15:21695015-21695037 CCAGTGAGGGCTCTGCAGGGCTC No data
Right 1123578369 15:21695059-21695081 GAGGGAAATCAGCAGGAGGTAGG No data
1123578363_1123578369 -4 Left 1123578363 15:21695040-21695062 CCCGAGCAGGAGCTGGGCTGAGG No data
Right 1123578369 15:21695059-21695081 GAGGGAAATCAGCAGGAGGTAGG No data
1123578355_1123578369 22 Left 1123578355 15:21695014-21695036 CCCAGTGAGGGCTCTGCAGGGCT No data
Right 1123578369 15:21695059-21695081 GAGGGAAATCAGCAGGAGGTAGG No data
1123578362_1123578369 -3 Left 1123578362 15:21695039-21695061 CCCCGAGCAGGAGCTGGGCTGAG No data
Right 1123578369 15:21695059-21695081 GAGGGAAATCAGCAGGAGGTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1123578369 Original CRISPR GAGGGAAATCAGCAGGAGGT AGG Intergenic
No off target data available for this crispr