ID: 1123582837

View in Genome Browser
Species Human (GRCh38)
Location 15:21731447-21731469
Sequence GGGCACTCGGAACCGCCAGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1123582837_1123582847 1 Left 1123582837 15:21731447-21731469 CCCCCTGGCGGTTCCGAGTGCCC No data
Right 1123582847 15:21731471-21731493 CTGGTGTCCTGAGCTATCCCTGG No data
1123582837_1123582848 4 Left 1123582837 15:21731447-21731469 CCCCCTGGCGGTTCCGAGTGCCC No data
Right 1123582848 15:21731474-21731496 GTGTCCTGAGCTATCCCTGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1123582837 Original CRISPR GGGCACTCGGAACCGCCAGG GGG (reversed) Intergenic
No off target data available for this crispr