ID: 1123584091

View in Genome Browser
Species Human (GRCh38)
Location 15:21741871-21741893
Sequence TTGGAGTGAGGGATTTTAAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1123584091_1123584094 -8 Left 1123584091 15:21741871-21741893 CCTCTTAAAATCCCTCACTCCAA No data
Right 1123584094 15:21741886-21741908 CACTCCAAATACAGAGCCACTGG No data
1123584091_1123584095 -7 Left 1123584091 15:21741871-21741893 CCTCTTAAAATCCCTCACTCCAA No data
Right 1123584095 15:21741887-21741909 ACTCCAAATACAGAGCCACTGGG No data
1123584091_1123584101 26 Left 1123584091 15:21741871-21741893 CCTCTTAAAATCCCTCACTCCAA No data
Right 1123584101 15:21741920-21741942 CAGCATATGAATTTAAGAGAAGG No data
1123584091_1123584098 -1 Left 1123584091 15:21741871-21741893 CCTCTTAAAATCCCTCACTCCAA No data
Right 1123584098 15:21741893-21741915 AATACAGAGCCACTGGGATTGGG No data
1123584091_1123584099 0 Left 1123584091 15:21741871-21741893 CCTCTTAAAATCCCTCACTCCAA No data
Right 1123584099 15:21741894-21741916 ATACAGAGCCACTGGGATTGGGG No data
1123584091_1123584097 -2 Left 1123584091 15:21741871-21741893 CCTCTTAAAATCCCTCACTCCAA No data
Right 1123584097 15:21741892-21741914 AAATACAGAGCCACTGGGATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1123584091 Original CRISPR TTGGAGTGAGGGATTTTAAG AGG (reversed) Intergenic
No off target data available for this crispr