ID: 1123586105

View in Genome Browser
Species Human (GRCh38)
Location 15:21762008-21762030
Sequence TCTCACATACAGAAGGTGGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1123586105_1123586112 26 Left 1123586105 15:21762008-21762030 CCAGCCACCTTCTGTATGTGAGA No data
Right 1123586112 15:21762057-21762079 TTCCTTCCATTCTGGCTGGCTGG No data
1123586105_1123586110 18 Left 1123586105 15:21762008-21762030 CCAGCCACCTTCTGTATGTGAGA No data
Right 1123586110 15:21762049-21762071 GCTGTTAGTTCCTTCCATTCTGG No data
1123586105_1123586113 27 Left 1123586105 15:21762008-21762030 CCAGCCACCTTCTGTATGTGAGA No data
Right 1123586113 15:21762058-21762080 TCCTTCCATTCTGGCTGGCTGGG No data
1123586105_1123586111 22 Left 1123586105 15:21762008-21762030 CCAGCCACCTTCTGTATGTGAGA No data
Right 1123586111 15:21762053-21762075 TTAGTTCCTTCCATTCTGGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1123586105 Original CRISPR TCTCACATACAGAAGGTGGC TGG (reversed) Intergenic
No off target data available for this crispr