ID: 1123586111

View in Genome Browser
Species Human (GRCh38)
Location 15:21762053-21762075
Sequence TTAGTTCCTTCCATTCTGGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1123586105_1123586111 22 Left 1123586105 15:21762008-21762030 CCAGCCACCTTCTGTATGTGAGA No data
Right 1123586111 15:21762053-21762075 TTAGTTCCTTCCATTCTGGCTGG No data
1123586104_1123586111 29 Left 1123586104 15:21762001-21762023 CCTCATGCCAGCCACCTTCTGTA No data
Right 1123586111 15:21762053-21762075 TTAGTTCCTTCCATTCTGGCTGG No data
1123586106_1123586111 18 Left 1123586106 15:21762012-21762034 CCACCTTCTGTATGTGAGACCGT No data
Right 1123586111 15:21762053-21762075 TTAGTTCCTTCCATTCTGGCTGG No data
1123586108_1123586111 -1 Left 1123586108 15:21762031-21762053 CCGTGCTGCTTGCCAAAAGCTGT No data
Right 1123586111 15:21762053-21762075 TTAGTTCCTTCCATTCTGGCTGG No data
1123586107_1123586111 15 Left 1123586107 15:21762015-21762037 CCTTCTGTATGTGAGACCGTGCT No data
Right 1123586111 15:21762053-21762075 TTAGTTCCTTCCATTCTGGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1123586111 Original CRISPR TTAGTTCCTTCCATTCTGGC TGG Intergenic
No off target data available for this crispr