ID: 1123586113

View in Genome Browser
Species Human (GRCh38)
Location 15:21762058-21762080
Sequence TCCTTCCATTCTGGCTGGCT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1123586107_1123586113 20 Left 1123586107 15:21762015-21762037 CCTTCTGTATGTGAGACCGTGCT No data
Right 1123586113 15:21762058-21762080 TCCTTCCATTCTGGCTGGCTGGG No data
1123586105_1123586113 27 Left 1123586105 15:21762008-21762030 CCAGCCACCTTCTGTATGTGAGA No data
Right 1123586113 15:21762058-21762080 TCCTTCCATTCTGGCTGGCTGGG No data
1123586109_1123586113 -8 Left 1123586109 15:21762043-21762065 CCAAAAGCTGTTAGTTCCTTCCA No data
Right 1123586113 15:21762058-21762080 TCCTTCCATTCTGGCTGGCTGGG No data
1123586108_1123586113 4 Left 1123586108 15:21762031-21762053 CCGTGCTGCTTGCCAAAAGCTGT No data
Right 1123586113 15:21762058-21762080 TCCTTCCATTCTGGCTGGCTGGG No data
1123586106_1123586113 23 Left 1123586106 15:21762012-21762034 CCACCTTCTGTATGTGAGACCGT No data
Right 1123586113 15:21762058-21762080 TCCTTCCATTCTGGCTGGCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1123586113 Original CRISPR TCCTTCCATTCTGGCTGGCT GGG Intergenic
No off target data available for this crispr