ID: 1123594106

View in Genome Browser
Species Human (GRCh38)
Location 15:21889095-21889117
Sequence TGAGCTCTGGGTGCGCCCGG CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1123594102_1123594106 -10 Left 1123594102 15:21889082-21889104 CCGGCACGCAAGGTGAGCTCTGG No data
Right 1123594106 15:21889095-21889117 TGAGCTCTGGGTGCGCCCGGCGG No data
1123594098_1123594106 0 Left 1123594098 15:21889072-21889094 CCTCCACCGGCCGGCACGCAAGG No data
Right 1123594106 15:21889095-21889117 TGAGCTCTGGGTGCGCCCGGCGG No data
1123594100_1123594106 -3 Left 1123594100 15:21889075-21889097 CCACCGGCCGGCACGCAAGGTGA No data
Right 1123594106 15:21889095-21889117 TGAGCTCTGGGTGCGCCCGGCGG No data
1123594096_1123594106 11 Left 1123594096 15:21889061-21889083 CCTATGGCTCGCCTCCACCGGCC No data
Right 1123594106 15:21889095-21889117 TGAGCTCTGGGTGCGCCCGGCGG No data
1123594101_1123594106 -6 Left 1123594101 15:21889078-21889100 CCGGCCGGCACGCAAGGTGAGCT No data
Right 1123594106 15:21889095-21889117 TGAGCTCTGGGTGCGCCCGGCGG No data
1123594094_1123594106 17 Left 1123594094 15:21889055-21889077 CCGTCACCTATGGCTCGCCTCCA No data
Right 1123594106 15:21889095-21889117 TGAGCTCTGGGTGCGCCCGGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1123594106 Original CRISPR TGAGCTCTGGGTGCGCCCGG CGG Intergenic
No off target data available for this crispr