ID: 1123594711

View in Genome Browser
Species Human (GRCh38)
Location 15:21893828-21893850
Sequence ATGGACAAAAGTGCCTTTAT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1123594711_1123594717 7 Left 1123594711 15:21893828-21893850 CCCATAAAGGCACTTTTGTCCAT No data
Right 1123594717 15:21893858-21893880 TGCAAAAGTATTGTAGCTGTGGG No data
1123594711_1123594716 6 Left 1123594711 15:21893828-21893850 CCCATAAAGGCACTTTTGTCCAT No data
Right 1123594716 15:21893857-21893879 CTGCAAAAGTATTGTAGCTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1123594711 Original CRISPR ATGGACAAAAGTGCCTTTAT GGG (reversed) Intergenic
No off target data available for this crispr