ID: 1123594717

View in Genome Browser
Species Human (GRCh38)
Location 15:21893858-21893880
Sequence TGCAAAAGTATTGTAGCTGT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1123594707_1123594717 26 Left 1123594707 15:21893809-21893831 CCTCTCTAATCCCAAAGCTCCCA No data
Right 1123594717 15:21893858-21893880 TGCAAAAGTATTGTAGCTGTGGG No data
1123594710_1123594717 15 Left 1123594710 15:21893820-21893842 CCAAAGCTCCCATAAAGGCACTT No data
Right 1123594717 15:21893858-21893880 TGCAAAAGTATTGTAGCTGTGGG No data
1123594706_1123594717 27 Left 1123594706 15:21893808-21893830 CCCTCTCTAATCCCAAAGCTCCC No data
Right 1123594717 15:21893858-21893880 TGCAAAAGTATTGTAGCTGTGGG No data
1123594712_1123594717 6 Left 1123594712 15:21893829-21893851 CCATAAAGGCACTTTTGTCCATG No data
Right 1123594717 15:21893858-21893880 TGCAAAAGTATTGTAGCTGTGGG No data
1123594709_1123594717 16 Left 1123594709 15:21893819-21893841 CCCAAAGCTCCCATAAAGGCACT No data
Right 1123594717 15:21893858-21893880 TGCAAAAGTATTGTAGCTGTGGG No data
1123594711_1123594717 7 Left 1123594711 15:21893828-21893850 CCCATAAAGGCACTTTTGTCCAT No data
Right 1123594717 15:21893858-21893880 TGCAAAAGTATTGTAGCTGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1123594717 Original CRISPR TGCAAAAGTATTGTAGCTGT GGG Intergenic
No off target data available for this crispr