ID: 1123594816

View in Genome Browser
Species Human (GRCh38)
Location 15:21895434-21895456
Sequence TAGCTAAAGGAATTTGGTGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1123594816_1123594819 8 Left 1123594816 15:21895434-21895456 CCAGCACCAAATTCCTTTAGCTA No data
Right 1123594819 15:21895465-21895487 TCACAATGTATTCCAAAATCAGG No data
1123594816_1123594820 11 Left 1123594816 15:21895434-21895456 CCAGCACCAAATTCCTTTAGCTA No data
Right 1123594820 15:21895468-21895490 CAATGTATTCCAAAATCAGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1123594816 Original CRISPR TAGCTAAAGGAATTTGGTGC TGG (reversed) Intergenic
No off target data available for this crispr