ID: 1123619350

View in Genome Browser
Species Human (GRCh38)
Location 15:22173462-22173484
Sequence GTGTCATGAGCGCCCCCTGG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1123619337_1123619350 24 Left 1123619337 15:22173415-22173437 CCCCCTGGTGGTTCTGAGCATGC No data
Right 1123619350 15:22173462-22173484 GTGTCATGAGCGCCCCCTGGTGG No data
1123619340_1123619350 21 Left 1123619340 15:22173418-22173440 CCTGGTGGTTCTGAGCATGCCCT No data
Right 1123619350 15:22173462-22173484 GTGTCATGAGCGCCCCCTGGTGG No data
1123619338_1123619350 23 Left 1123619338 15:22173416-22173438 CCCCTGGTGGTTCTGAGCATGCC No data
Right 1123619350 15:22173462-22173484 GTGTCATGAGCGCCCCCTGGTGG No data
1123619339_1123619350 22 Left 1123619339 15:22173417-22173439 CCCTGGTGGTTCTGAGCATGCCC No data
Right 1123619350 15:22173462-22173484 GTGTCATGAGCGCCCCCTGGTGG No data
1123619343_1123619350 2 Left 1123619343 15:22173437-22173459 CCCTGGTGGTTCTGACCGCCCGC No data
Right 1123619350 15:22173462-22173484 GTGTCATGAGCGCCCCCTGGTGG No data
1123619344_1123619350 1 Left 1123619344 15:22173438-22173460 CCTGGTGGTTCTGACCGCCCGCT No data
Right 1123619350 15:22173462-22173484 GTGTCATGAGCGCCCCCTGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1123619350 Original CRISPR GTGTCATGAGCGCCCCCTGG TGG Intergenic
No off target data available for this crispr