ID: 1123620741

View in Genome Browser
Species Human (GRCh38)
Location 15:22184474-22184496
Sequence TTGGAGTGAGGGATTTTAAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1123620741_1123620744 -8 Left 1123620741 15:22184474-22184496 CCTCTTAAAATCCCTCACTCCAA No data
Right 1123620744 15:22184489-22184511 CACTCCAAATACAGAGCCACTGG No data
1123620741_1123620747 -2 Left 1123620741 15:22184474-22184496 CCTCTTAAAATCCCTCACTCCAA No data
Right 1123620747 15:22184495-22184517 AAATACAGAGCCACTGGGATTGG No data
1123620741_1123620751 26 Left 1123620741 15:22184474-22184496 CCTCTTAAAATCCCTCACTCCAA No data
Right 1123620751 15:22184523-22184545 CAGCATATGAATTTAAGAGAAGG No data
1123620741_1123620749 0 Left 1123620741 15:22184474-22184496 CCTCTTAAAATCCCTCACTCCAA No data
Right 1123620749 15:22184497-22184519 ATACAGAGCCACTGGGATTGGGG No data
1123620741_1123620745 -7 Left 1123620741 15:22184474-22184496 CCTCTTAAAATCCCTCACTCCAA No data
Right 1123620745 15:22184490-22184512 ACTCCAAATACAGAGCCACTGGG No data
1123620741_1123620748 -1 Left 1123620741 15:22184474-22184496 CCTCTTAAAATCCCTCACTCCAA No data
Right 1123620748 15:22184496-22184518 AATACAGAGCCACTGGGATTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1123620741 Original CRISPR TTGGAGTGAGGGATTTTAAG AGG (reversed) Intergenic
No off target data available for this crispr