ID: 1123627987

View in Genome Browser
Species Human (GRCh38)
Location 15:22240605-22240627
Sequence GGCGCGGATCGCCGCGCCGT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1123627979_1123627987 22 Left 1123627979 15:22240560-22240582 CCCACAGGAAAAAGAAACAGGAA No data
Right 1123627987 15:22240605-22240627 GGCGCGGATCGCCGCGCCGTGGG No data
1123627980_1123627987 21 Left 1123627980 15:22240561-22240583 CCACAGGAAAAAGAAACAGGAAG No data
Right 1123627987 15:22240605-22240627 GGCGCGGATCGCCGCGCCGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1123627987 Original CRISPR GGCGCGGATCGCCGCGCCGT GGG Intergenic
No off target data available for this crispr