ID: 1123630073

View in Genome Browser
Species Human (GRCh38)
Location 15:22255052-22255074
Sequence TACCAGAGGCTGCAAGAGAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1123630073_1123630077 -5 Left 1123630073 15:22255052-22255074 CCTGTCTCTTGCAGCCTCTGGTA No data
Right 1123630077 15:22255070-22255092 TGGTAGGCCCAGGCACCCCTCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1123630073 Original CRISPR TACCAGAGGCTGCAAGAGAC AGG (reversed) Intergenic
No off target data available for this crispr