ID: 1123630596

View in Genome Browser
Species Human (GRCh38)
Location 15:22257755-22257777
Sequence TCCGCCGCCCGTCCGCCGCG CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1123630586_1123630596 26 Left 1123630586 15:22257706-22257728 CCTCGGCCGGTGCCTGCTCTGCC No data
Right 1123630596 15:22257755-22257777 TCCGCCGCCCGTCCGCCGCGCGG No data
1123630587_1123630596 20 Left 1123630587 15:22257712-22257734 CCGGTGCCTGCTCTGCCGTCGTC No data
Right 1123630596 15:22257755-22257777 TCCGCCGCCCGTCCGCCGCGCGG No data
1123630591_1123630596 -10 Left 1123630591 15:22257742-22257764 CCGCCGCCGCCCGTCCGCCGCCC No data
Right 1123630596 15:22257755-22257777 TCCGCCGCCCGTCCGCCGCGCGG No data
1123630589_1123630596 5 Left 1123630589 15:22257727-22257749 CCGTCGTCGCCGTCGCCGCCGCC No data
Right 1123630596 15:22257755-22257777 TCCGCCGCCCGTCCGCCGCGCGG No data
1123630590_1123630596 -4 Left 1123630590 15:22257736-22257758 CCGTCGCCGCCGCCGCCCGTCCG No data
Right 1123630596 15:22257755-22257777 TCCGCCGCCCGTCCGCCGCGCGG No data
1123630588_1123630596 14 Left 1123630588 15:22257718-22257740 CCTGCTCTGCCGTCGTCGCCGTC No data
Right 1123630596 15:22257755-22257777 TCCGCCGCCCGTCCGCCGCGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1123630596 Original CRISPR TCCGCCGCCCGTCCGCCGCG CGG Intergenic
No off target data available for this crispr