ID: 1123635444

View in Genome Browser
Species Human (GRCh38)
Location 15:22303165-22303187
Sequence CCCCTACTGACCTCCAAGCC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1123635435_1123635444 12 Left 1123635435 15:22303130-22303152 CCCAGGGATTTCCATTCTCCTCT No data
Right 1123635444 15:22303165-22303187 CCCCTACTGACCTCCAAGCCAGG No data
1123635433_1123635444 18 Left 1123635433 15:22303124-22303146 CCATTCCCCAGGGATTTCCATTC No data
Right 1123635444 15:22303165-22303187 CCCCTACTGACCTCCAAGCCAGG No data
1123635440_1123635444 1 Left 1123635440 15:22303141-22303163 CCATTCTCCTCTGGGAGGCATGG No data
Right 1123635444 15:22303165-22303187 CCCCTACTGACCTCCAAGCCAGG No data
1123635434_1123635444 13 Left 1123635434 15:22303129-22303151 CCCCAGGGATTTCCATTCTCCTC No data
Right 1123635444 15:22303165-22303187 CCCCTACTGACCTCCAAGCCAGG No data
1123635442_1123635444 -6 Left 1123635442 15:22303148-22303170 CCTCTGGGAGGCATGGACCCCTA No data
Right 1123635444 15:22303165-22303187 CCCCTACTGACCTCCAAGCCAGG No data
1123635436_1123635444 11 Left 1123635436 15:22303131-22303153 CCAGGGATTTCCATTCTCCTCTG No data
Right 1123635444 15:22303165-22303187 CCCCTACTGACCTCCAAGCCAGG No data
1123635432_1123635444 19 Left 1123635432 15:22303123-22303145 CCCATTCCCCAGGGATTTCCATT No data
Right 1123635444 15:22303165-22303187 CCCCTACTGACCTCCAAGCCAGG No data
1123635430_1123635444 28 Left 1123635430 15:22303114-22303136 CCATAGATGCCCATTCCCCAGGG No data
Right 1123635444 15:22303165-22303187 CCCCTACTGACCTCCAAGCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1123635444 Original CRISPR CCCCTACTGACCTCCAAGCC AGG Intergenic
No off target data available for this crispr