ID: 1123635985

View in Genome Browser
Species Human (GRCh38)
Location 15:22359468-22359490
Sequence GGCTGCCCCAAAGTTCCCAT CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1123635984_1123635985 -7 Left 1123635984 15:22359452-22359474 CCTAAAAAAAAATAGAGGCTGCC No data
Right 1123635985 15:22359468-22359490 GGCTGCCCCAAAGTTCCCATCGG No data
1123635982_1123635985 2 Left 1123635982 15:22359443-22359465 CCACAGAATCCTAAAAAAAAATA No data
Right 1123635985 15:22359468-22359490 GGCTGCCCCAAAGTTCCCATCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1123635985 Original CRISPR GGCTGCCCCAAAGTTCCCAT CGG Intergenic
No off target data available for this crispr