ID: 1123637326

View in Genome Browser
Species Human (GRCh38)
Location 15:22371633-22371655
Sequence CGCCGCCCGAGGAGAACGGG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1123637313_1123637326 11 Left 1123637313 15:22371599-22371621 CCGCCGCTGTGAGCGGCGCAGTC No data
Right 1123637326 15:22371633-22371655 CGCCGCCCGAGGAGAACGGGAGG No data
1123637311_1123637326 26 Left 1123637311 15:22371584-22371606 CCGGGCGCAGAAGAGCCGCCGCT No data
Right 1123637326 15:22371633-22371655 CGCCGCCCGAGGAGAACGGGAGG No data
1123637314_1123637326 8 Left 1123637314 15:22371602-22371624 CCGCTGTGAGCGGCGCAGTCCCG No data
Right 1123637326 15:22371633-22371655 CGCCGCCCGAGGAGAACGGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1123637326 Original CRISPR CGCCGCCCGAGGAGAACGGG AGG Intergenic