ID: 1123641581

View in Genome Browser
Species Human (GRCh38)
Location 15:22405443-22405465
Sequence CAATCAGAGGCCTCTCTGAC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1123641575_1123641581 10 Left 1123641575 15:22405410-22405432 CCAAGAGGGTCCCAGTCAGCTGA No data
Right 1123641581 15:22405443-22405465 CAATCAGAGGCCTCTCTGACTGG No data
1123641576_1123641581 0 Left 1123641576 15:22405420-22405442 CCCAGTCAGCTGACACCCATGAG No data
Right 1123641581 15:22405443-22405465 CAATCAGAGGCCTCTCTGACTGG No data
1123641574_1123641581 11 Left 1123641574 15:22405409-22405431 CCCAAGAGGGTCCCAGTCAGCTG No data
Right 1123641581 15:22405443-22405465 CAATCAGAGGCCTCTCTGACTGG No data
1123641573_1123641581 20 Left 1123641573 15:22405400-22405422 CCAGAGGGTCCCAAGAGGGTCCC No data
Right 1123641581 15:22405443-22405465 CAATCAGAGGCCTCTCTGACTGG No data
1123641577_1123641581 -1 Left 1123641577 15:22405421-22405443 CCAGTCAGCTGACACCCATGAGC No data
Right 1123641581 15:22405443-22405465 CAATCAGAGGCCTCTCTGACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1123641581 Original CRISPR CAATCAGAGGCCTCTCTGAC TGG Intergenic
No off target data available for this crispr