ID: 1123644375

View in Genome Browser
Species Human (GRCh38)
Location 15:22428405-22428427
Sequence CGGCTTTATGGACCACCTGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1123644375_1123644384 10 Left 1123644375 15:22428405-22428427 CCTCCAGGTGGTCCATAAAGCCG No data
Right 1123644384 15:22428438-22428460 AAAATAATGGGGTCACATCTCGG No data
1123644375_1123644381 -2 Left 1123644375 15:22428405-22428427 CCTCCAGGTGGTCCATAAAGCCG No data
Right 1123644381 15:22428426-22428448 CGCTCTGGAGCCAAAATAATGGG No data
1123644375_1123644382 -1 Left 1123644375 15:22428405-22428427 CCTCCAGGTGGTCCATAAAGCCG No data
Right 1123644382 15:22428427-22428449 GCTCTGGAGCCAAAATAATGGGG No data
1123644375_1123644385 28 Left 1123644375 15:22428405-22428427 CCTCCAGGTGGTCCATAAAGCCG No data
Right 1123644385 15:22428456-22428478 CTCGGCAGCGACCTGCCCTCAGG No data
1123644375_1123644380 -3 Left 1123644375 15:22428405-22428427 CCTCCAGGTGGTCCATAAAGCCG No data
Right 1123644380 15:22428425-22428447 CCGCTCTGGAGCCAAAATAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1123644375 Original CRISPR CGGCTTTATGGACCACCTGG AGG (reversed) Intergenic
No off target data available for this crispr