ID: 1123645510

View in Genome Browser
Species Human (GRCh38)
Location 15:22434855-22434877
Sequence CAGGCTAGCACTTCCCCAAG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1123645506_1123645510 -8 Left 1123645506 15:22434840-22434862 CCCCTGACAACCAGTCAGGCTAG No data
Right 1123645510 15:22434855-22434877 CAGGCTAGCACTTCCCCAAGAGG No data
1123645508_1123645510 -10 Left 1123645508 15:22434842-22434864 CCTGACAACCAGTCAGGCTAGCA No data
Right 1123645510 15:22434855-22434877 CAGGCTAGCACTTCCCCAAGAGG No data
1123645507_1123645510 -9 Left 1123645507 15:22434841-22434863 CCCTGACAACCAGTCAGGCTAGC No data
Right 1123645510 15:22434855-22434877 CAGGCTAGCACTTCCCCAAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1123645510 Original CRISPR CAGGCTAGCACTTCCCCAAG AGG Intergenic
No off target data available for this crispr