ID: 1123645957

View in Genome Browser
Species Human (GRCh38)
Location 15:22437648-22437670
Sequence CTGCCCTCACCAATCACCCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 11 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1123645957_1123645962 1 Left 1123645957 15:22437648-22437670 CCTGGGGTGATTGGTGAGGGCAG No data
Right 1123645962 15:22437672-22437694 GACTGGGCTGCTTGCTGAAGGGG No data
1123645957_1123645970 30 Left 1123645957 15:22437648-22437670 CCTGGGGTGATTGGTGAGGGCAG No data
Right 1123645970 15:22437701-22437723 TGACTGGCAAAACTTTGGTGGGG No data
1123645957_1123645963 4 Left 1123645957 15:22437648-22437670 CCTGGGGTGATTGGTGAGGGCAG No data
Right 1123645963 15:22437675-22437697 TGGGCTGCTTGCTGAAGGGGTGG No data
1123645957_1123645967 25 Left 1123645957 15:22437648-22437670 CCTGGGGTGATTGGTGAGGGCAG No data
Right 1123645967 15:22437696-22437718 GGGGCTGACTGGCAAAACTTTGG No data
1123645957_1123645968 28 Left 1123645957 15:22437648-22437670 CCTGGGGTGATTGGTGAGGGCAG No data
Right 1123645968 15:22437699-22437721 GCTGACTGGCAAAACTTTGGTGG No data
1123645957_1123645961 0 Left 1123645957 15:22437648-22437670 CCTGGGGTGATTGGTGAGGGCAG No data
Right 1123645961 15:22437671-22437693 AGACTGGGCTGCTTGCTGAAGGG No data
1123645957_1123645966 14 Left 1123645957 15:22437648-22437670 CCTGGGGTGATTGGTGAGGGCAG No data
Right 1123645966 15:22437685-22437707 GCTGAAGGGGTGGGGCTGACTGG No data
1123645957_1123645960 -1 Left 1123645957 15:22437648-22437670 CCTGGGGTGATTGGTGAGGGCAG No data
Right 1123645960 15:22437670-22437692 GAGACTGGGCTGCTTGCTGAAGG No data
1123645957_1123645964 5 Left 1123645957 15:22437648-22437670 CCTGGGGTGATTGGTGAGGGCAG No data
Right 1123645964 15:22437676-22437698 GGGCTGCTTGCTGAAGGGGTGGG No data
1123645957_1123645969 29 Left 1123645957 15:22437648-22437670 CCTGGGGTGATTGGTGAGGGCAG No data
Right 1123645969 15:22437700-22437722 CTGACTGGCAAAACTTTGGTGGG No data
1123645957_1123645965 6 Left 1123645957 15:22437648-22437670 CCTGGGGTGATTGGTGAGGGCAG No data
Right 1123645965 15:22437677-22437699 GGCTGCTTGCTGAAGGGGTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1123645957 Original CRISPR CTGCCCTCACCAATCACCCC AGG (reversed) Intergenic
No off target data available for this crispr