ID: 1123649052

View in Genome Browser
Species Human (GRCh38)
Location 15:22464352-22464374
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 512
Summary {0: 6, 1: 3, 2: 3, 3: 54, 4: 446}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1123649052_1123649058 -3 Left 1123649052 15:22464352-22464374 CCAAGCTCCTGCTGCCACAGGTG 0: 6
1: 3
2: 3
3: 54
4: 446
Right 1123649058 15:22464372-22464394 GTGAGCAGCTGCAGCCCCGGGGG 0: 6
1: 4
2: 6
3: 36
4: 310
1123649052_1123649057 -4 Left 1123649052 15:22464352-22464374 CCAAGCTCCTGCTGCCACAGGTG 0: 6
1: 3
2: 3
3: 54
4: 446
Right 1123649057 15:22464371-22464393 GGTGAGCAGCTGCAGCCCCGGGG 0: 6
1: 4
2: 4
3: 34
4: 394
1123649052_1123649056 -5 Left 1123649052 15:22464352-22464374 CCAAGCTCCTGCTGCCACAGGTG 0: 6
1: 3
2: 3
3: 54
4: 446
Right 1123649056 15:22464370-22464392 AGGTGAGCAGCTGCAGCCCCGGG 0: 6
1: 5
2: 5
3: 60
4: 537
1123649052_1123649060 4 Left 1123649052 15:22464352-22464374 CCAAGCTCCTGCTGCCACAGGTG 0: 6
1: 3
2: 3
3: 54
4: 446
Right 1123649060 15:22464379-22464401 GCTGCAGCCCCGGGGGTTGTGGG 0: 8
1: 1
2: 4
3: 27
4: 234
1123649052_1123649055 -6 Left 1123649052 15:22464352-22464374 CCAAGCTCCTGCTGCCACAGGTG 0: 6
1: 3
2: 3
3: 54
4: 446
Right 1123649055 15:22464369-22464391 CAGGTGAGCAGCTGCAGCCCCGG 0: 6
1: 4
2: 7
3: 74
4: 661
1123649052_1123649059 3 Left 1123649052 15:22464352-22464374 CCAAGCTCCTGCTGCCACAGGTG 0: 6
1: 3
2: 3
3: 54
4: 446
Right 1123649059 15:22464378-22464400 AGCTGCAGCCCCGGGGGTTGTGG 0: 8
1: 0
2: 5
3: 76
4: 794
1123649052_1123649066 28 Left 1123649052 15:22464352-22464374 CCAAGCTCCTGCTGCCACAGGTG 0: 6
1: 3
2: 3
3: 54
4: 446
Right 1123649066 15:22464403-22464425 GACCCATCCAGCTGGGACCATGG 0: 6
1: 1
2: 4
3: 19
4: 157
1123649052_1123649065 21 Left 1123649052 15:22464352-22464374 CCAAGCTCCTGCTGCCACAGGTG 0: 6
1: 3
2: 3
3: 54
4: 446
Right 1123649065 15:22464396-22464418 TGTGGGAGACCCATCCAGCTGGG 0: 7
1: 0
2: 3
3: 14
4: 124
1123649052_1123649064 20 Left 1123649052 15:22464352-22464374 CCAAGCTCCTGCTGCCACAGGTG 0: 6
1: 3
2: 3
3: 54
4: 446
Right 1123649064 15:22464395-22464417 TTGTGGGAGACCCATCCAGCTGG 0: 6
1: 0
2: 3
3: 12
4: 130

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1123649052 Original CRISPR CACCTGTGGCAGCAGGAGCT TGG (reversed) Exonic
900129798 1:1082574-1082596 CAGCTTTGGCTGCAGGCGCTGGG + Exonic
900206164 1:1432772-1432794 CCCCCGTGCCAGCAGCAGCTGGG - Intergenic
900226127 1:1534403-1534425 CCCCCGGGGCAGCAGGAGCCAGG + Exonic
900978079 1:6029602-6029624 CAGCGGGGGCTGCAGGAGCTGGG - Intronic
901156891 1:7146219-7146241 CACCCCTCGCAGCAGGAGCTTGG + Intronic
901403709 1:9032029-9032051 CTCCAGAGCCAGCAGGAGCTAGG - Intergenic
902192088 1:14770957-14770979 CACCTGTGGGATGAGGAGCTGGG - Intronic
903155559 1:21440251-21440273 AACCTGCGGCGCCAGGAGCTGGG + Intronic
903296484 1:22346589-22346611 CAGCTGCAGCAGCAGAAGCTGGG - Intergenic
904295940 1:29519776-29519798 CAGCTTGGGCAGCAGGAGCCAGG - Intergenic
904494704 1:30880036-30880058 CACATGGGGCAGGAGGAGCTGGG + Intronic
904716420 1:32471128-32471150 CTCCTGTGGTACCAAGAGCTTGG + Exonic
905852237 1:41282906-41282928 CCCCTTTGGCAGCAGCTGCTGGG - Intergenic
905915507 1:41681732-41681754 CACCTGAGGGAGGAGGGGCTGGG + Intronic
905923893 1:41736469-41736491 TTTCTGTGGCAGAAGGAGCTGGG - Intronic
906461187 1:46035901-46035923 CACCTGAGGCATCAGGCACTTGG - Exonic
906678109 1:47708030-47708052 CACCTGGGACAGCGGGATCTGGG - Intergenic
907332439 1:53679905-53679927 CACCTGAGGCAGCCTGACCTTGG + Intronic
908932537 1:69334351-69334373 TGCCTGTTGCAGCAGGTGCTGGG + Intergenic
908953621 1:69593845-69593867 CATCTGTGGAAGCAGAGGCTGGG + Intronic
912389213 1:109290314-109290336 CTCCAGTGGAAGCAGGACCTAGG - Intergenic
912450667 1:109765661-109765683 CGGCTGAGGCACCAGGAGCTGGG + Intronic
913421677 1:118676816-118676838 CACGTCTGTCAGCAGAAGCTTGG - Intergenic
914942953 1:152038558-152038580 CACCTGTGAGAGCAGGTGCAGGG - Intronic
915276492 1:154792309-154792331 CACCAGTGACAGAAGGAGGTGGG + Intronic
915355997 1:155255435-155255457 GACCTGCGGCAGCCGGAGCTCGG - Intronic
915530396 1:156499667-156499689 CACCTATGGCAGGCGGAGCTGGG - Intronic
916375841 1:164152420-164152442 TAGCTGTGGCCTCAGGAGCTAGG - Intergenic
916673273 1:167044251-167044273 CACCTTCGGCCACAGGAGCTTGG + Intergenic
919395142 1:197036588-197036610 CACCGGTGGCAGCAGCAGGATGG - Intergenic
920021401 1:202958854-202958876 TGCCTGTGGGAGCAGGAACTGGG - Intergenic
920499316 1:206476450-206476472 CTCCTGTGGAAGCAGGAGGTGGG - Intronic
920945907 1:210528291-210528313 CCCCTGTGGTAGAAGGAGCAGGG + Intronic
921863518 1:220064413-220064435 CACCTGTGGAAGGAGGAGGAGGG + Intronic
922349658 1:224724754-224724776 CACTTGAGGAAGCTGGAGCTTGG + Intronic
923034675 1:230277309-230277331 CACCTGTGCGAGACGGAGCTGGG + Intronic
924216153 1:241824548-241824570 AACCAGTGGCACCAGGAGCTGGG + Intergenic
1064544673 10:16438406-16438428 CACCTGTGGGAGACTGAGCTGGG - Intronic
1065041804 10:21705256-21705278 CAGCTGTGGCAGTAGCAGCAGGG + Intronic
1065195955 10:23265761-23265783 CAACTGTTTCTGCAGGAGCTAGG - Intergenic
1066451428 10:35533537-35533559 CACCTGGGACAGAGGGAGCTGGG - Intronic
1067098863 10:43320382-43320404 CACCGGCTCCAGCAGGAGCTTGG - Intergenic
1067346306 10:45441339-45441361 CACGTGTGCCACCAGCAGCTGGG - Exonic
1067429555 10:46234118-46234140 CACCTGGGGGAGCAGGTGATGGG + Intergenic
1069858698 10:71456636-71456658 CACCTGTGCCAGCCTGTGCTGGG + Intronic
1070736516 10:78867028-78867050 GTCCTGAGGCAGCAGGAGCCTGG - Intergenic
1072070250 10:91908626-91908648 CACTTCTGGAAGCAGGTGCTGGG - Exonic
1072564770 10:96608298-96608320 CACAGGTGGCAGAAGGAGCAAGG - Intronic
1074248183 10:111714740-111714762 TGCCTGTCGCAGCAGGGGCTGGG - Intergenic
1074971492 10:118542967-118542989 CTGATGTGGCAGGAGGAGCTTGG + Intergenic
1074974047 10:118566143-118566165 CACCTGTGGTCCCAGGAACTTGG - Intergenic
1075501699 10:122980597-122980619 CACCGGCTGCAGCAGGAGCAGGG + Exonic
1076212322 10:128658548-128658570 CACCTGGGGCACCTGGAGCATGG + Intergenic
1076335460 10:129703698-129703720 CACCTGGGGCTGCAGGATTTGGG - Intronic
1076741561 10:132488265-132488287 CCCCTGGAGCAGCAGGAGCTGGG + Intergenic
1076770495 10:132660568-132660590 CACCTGTGTCAGCAACAGGTGGG + Intronic
1077109087 11:854249-854271 CACCCGCAGCACCAGGAGCTTGG + Intronic
1077414449 11:2418242-2418264 CACCTTGGGCACCAGGAGGTGGG + Exonic
1077505468 11:2928115-2928137 CACCACAGGCAGCAGCAGCTCGG + Intergenic
1077757285 11:5046473-5046495 CACATGTAGAAGCAGCAGCTGGG - Intergenic
1078334277 11:10451245-10451267 CACCTGAGGCCGCTGGGGCTCGG - Intronic
1078694778 11:13620319-13620341 CACATGTGTCAGCAGCAGCAGGG + Intergenic
1078835512 11:15025743-15025765 CAGCTGTGGCAGAGGGAGCAGGG - Intronic
1079252243 11:18794753-18794775 CACATGTGACAGCTGGGGCTGGG - Intergenic
1080663588 11:34316617-34316639 CACCAGTGGCAACAGCAACTTGG - Intronic
1083773249 11:64879761-64879783 AACCTGTGGTAGCAGGACCCTGG + Intronic
1083857484 11:65400356-65400378 CACAGATGGCAGCAGGGGCTGGG - Intronic
1083891559 11:65598250-65598272 CTCCTAAGGCAGCTGGAGCTCGG + Exonic
1087792634 11:102423049-102423071 CACCTTTAGCAGCTTGAGCTAGG - Intronic
1088269172 11:108016377-108016399 CACCTGTGGGAGGATGAGGTGGG - Intronic
1090600474 11:128364671-128364693 AAGCTGTGGCAGCAAGTGCTGGG + Intergenic
1092158052 12:6297363-6297385 CTGCTATGGAAGCAGGAGCTTGG + Intergenic
1092525527 12:9307329-9307351 CACCTGGGGCACGAGGGGCTGGG - Intergenic
1094511284 12:31098012-31098034 CACCTGGGGCACGAGGGGCTGGG - Intronic
1094546632 12:31410529-31410551 CACCTGTGGTCCCAGCAGCTTGG - Intronic
1094547325 12:31416963-31416985 CACCTGTAGCACCAGTTGCTTGG + Intronic
1095234989 12:39785276-39785298 CAGCTGTGGCTGGAGCAGCTGGG - Intronic
1095891112 12:47235785-47235807 CACGTGGGCCAGCAGCAGCTGGG - Exonic
1096007282 12:48183646-48183668 CGAGTGTGGCAGCAGCAGCTGGG - Exonic
1096869055 12:54582086-54582108 CACCTGGGGCAACAGCAGCAAGG - Exonic
1097146548 12:56943357-56943379 CAGCTGTGGCTGCAGCAGCTGGG - Intergenic
1097777843 12:63668700-63668722 CACCGGAGGCTGCAGGCGCTGGG - Intronic
1100201943 12:92308037-92308059 CACCTGTGGCCCCAGGTACTTGG - Intergenic
1101597581 12:106180614-106180636 CATCTGTGGAAGGAGCAGCTAGG - Intergenic
1101710027 12:107256635-107256657 CATCTGGGGCAGCAGGGGCCAGG - Intergenic
1103303544 12:119946389-119946411 CACTGTGGGCAGCAGGAGCTCGG - Intergenic
1104664066 12:130635041-130635063 CCCCTGGGGCAGGGGGAGCTGGG - Intronic
1104719782 12:131038911-131038933 CACCTGGGGCAGATGGAGCAGGG + Intronic
1104771385 12:131366802-131366824 CACCTGTGGCCTGAGGAGCAGGG + Intergenic
1105306440 13:19172383-19172405 CAGCAGTGGCAGCAGCAGCAGGG - Intergenic
1105591489 13:21796773-21796795 CTCCTCTGGAAGCAGGTGCTCGG + Intergenic
1106308740 13:28534920-28534942 CCCGTGTTGCAGCAGCAGCTTGG - Intergenic
1107069466 13:36254970-36254992 CCCCTGTGGGGGCAGGAACTTGG + Intronic
1107080007 13:36364804-36364826 CCCCTGTGGCAGGAGGACCTTGG - Intronic
1107673411 13:42770150-42770172 CACCTGTGGCAGAAGGGGCTAGG - Intergenic
1110285923 13:73750402-73750424 CACATGTGGCAGCAGGTTCAAGG - Intronic
1113022747 13:105906364-105906386 CACCTGAAGCAACTGGAGCTGGG + Intergenic
1113384573 13:109836831-109836853 GACCTGTGGCAGGTGAAGCTAGG + Intergenic
1113875232 13:113590073-113590095 TACCAATGGCAGGAGGAGCTTGG - Intronic
1114359766 14:21958866-21958888 AACTTGTGGCAGCAGGATCAGGG + Intergenic
1114451612 14:22830130-22830152 CACCTGGGGGACCAGAAGCTGGG + Intronic
1115364681 14:32544541-32544563 CACCAGTGGGAGCAGGACTTGGG + Intronic
1115802434 14:37010350-37010372 CACCTATGGCAATAGGAGGTAGG - Intronic
1116127075 14:40801176-40801198 CAGCTGTGGCTGGAGCAGCTGGG + Intergenic
1116231999 14:42229375-42229397 GAGCTATGGCAGCTGGAGCTGGG + Intergenic
1116336606 14:43665565-43665587 CACCTGTAGCAGAGGGAGCATGG + Intergenic
1116997207 14:51336320-51336342 CACCTGTGAGATCAGGAGGTTGG - Intergenic
1117296231 14:54381931-54381953 TAGCAGTGGCAGCAGCAGCTAGG - Intergenic
1118280904 14:64427647-64427669 CAACAGTGACAGCAGGAGCTGGG - Intronic
1118897749 14:69960351-69960373 CAACTGTGGCTGAAGAAGCTTGG - Intronic
1119559488 14:75578782-75578804 CAAAAGTGGGAGCAGGAGCTTGG + Exonic
1119861186 14:77937357-77937379 CAGCTGTGGCAGCAGGGCCCTGG - Intergenic
1121583857 14:95049534-95049556 CCCCTGTGCCAGCCAGAGCTGGG - Intergenic
1121725251 14:96142783-96142805 CACTGGTGGGAGCAGCAGCTGGG + Intergenic
1122599500 14:102914357-102914379 CACCTGTGGCTGCAGGGTCAAGG - Intergenic
1122856904 14:104564249-104564271 CACCGGTGCCTGGAGGAGCTCGG - Intronic
1122931975 14:104937441-104937463 CAGCTGGGCCAGCAGAAGCTAGG - Exonic
1123469006 15:20536339-20536361 CACCTGTGGCAGCAGGAGCTTGG + Exonic
1123649052 15:22464352-22464374 CACCTGTGGCAGCAGGAGCTTGG - Exonic
1123729282 15:23131327-23131349 CACCTGTGGCAGCAGGAGCTTGG + Exonic
1123747450 15:23328809-23328831 CACCTGTGGCAGCAGGAGCTTGG + Intergenic
1123762245 15:23441976-23441998 CACCTGTGGCAGCAGGAACTTGG + Exonic
1124279811 15:28352661-28352683 CACCTGTGGCAGCAGGAGCTTGG + Intergenic
1124302887 15:28558943-28558965 CACCTGTGGCAGCAGGAGCTTGG - Intergenic
1124531983 15:30516593-30516615 CGCCTGTGGCAGCAGGAGCTGGG - Intergenic
1124593785 15:31077344-31077366 CACCTGGAGCAGAAGGAGGTGGG + Intronic
1124766670 15:32491052-32491074 CGCCTGTGGCAGCAGGAGCTGGG + Intergenic
1125796764 15:42409180-42409202 CGGAGGTGGCAGCAGGAGCTGGG - Intronic
1126756649 15:51931784-51931806 AACTTGTGGCATCAGGAGCCAGG + Intronic
1127234676 15:57036057-57036079 CCCTTCTGGCACCAGGAGCTGGG - Intronic
1128153505 15:65377714-65377736 CAGCAGCGGCAGCAGGAGCCGGG + Exonic
1128604730 15:69028164-69028186 CAACTGTGGCCGCAGGGCCTGGG - Intronic
1128800863 15:70496080-70496102 CACCTGTAGAAGCTGCAGCTGGG - Intergenic
1130539144 15:84809447-84809469 TAACTGTGGCAGCAGTTGCTGGG + Intergenic
1130675634 15:85949518-85949540 CCACTGTAGCAGCAGGACCTGGG + Intergenic
1130709259 15:86263691-86263713 CAACAGTGGCAGCAGCAACTAGG - Intronic
1131158704 15:90090627-90090649 CACGTGGGGCAGGATGAGCTGGG + Exonic
1131174323 15:90200886-90200908 CCCCAGTGTCAGCACGAGCTCGG + Intronic
1131249370 15:90820425-90820447 CACCTGGGCCAGCAGGAGTTGGG + Intergenic
1132326270 15:100973191-100973213 CCCGAGTGGCAGCAGGTGCTCGG + Intronic
1132720097 16:1311543-1311565 CACCTGAGACAGCAATAGCTAGG + Intronic
1132911177 16:2312922-2312944 CACCTGTGGCCCCAGCTGCTTGG + Intronic
1133100157 16:3474569-3474591 CACCCATGGCAGCAGGAGGGCGG + Intronic
1133149030 16:3812650-3812672 GACCTGTGGAGGCTGGAGCTGGG - Intronic
1134110784 16:11514356-11514378 CACCTGTGCCCGCTGGATCTTGG + Exonic
1134200047 16:12190629-12190651 CACATGGGGCAGAAAGAGCTTGG + Intronic
1136160211 16:28415024-28415046 CACAGGTGGCAGCTGCAGCTGGG - Intergenic
1136202877 16:28700266-28700288 CACAGGTGGCAGCTGCAGCTGGG + Intronic
1136606122 16:31335111-31335133 CACATGTGGCAGGAGGAGAGAGG + Intergenic
1137044257 16:35641536-35641558 CACCTGTAGCAGAAGAAGCCCGG + Intergenic
1139189466 16:64844768-64844790 CACCTGTGGCAGGAAGAGAAAGG + Intergenic
1140272882 16:73482247-73482269 CATCTGTGGCTGCAGGAGTAGGG - Intergenic
1141574265 16:84954091-84954113 CACCTGTGGCCCGATGAGCTCGG + Intergenic
1141627226 16:85267577-85267599 TACTTGTTGCAGCAGGTGCTGGG - Intergenic
1141699417 16:85635619-85635641 CAACTGCAGCAGCAGGAGCTGGG - Intronic
1142013237 16:87727866-87727888 CAGATGTGGCAGCTGGTGCTGGG - Intronic
1142045818 16:87924671-87924693 TCCCCGTGACAGCAGGAGCTGGG + Intronic
1142231628 16:88902830-88902852 CACAGGTGTCAGCAGGAGCAGGG - Intronic
1142231639 16:88902877-88902899 CACAGGTGTCAGCAGGAGCAGGG - Intronic
1142427136 16:90007201-90007223 CACCTGGGGCTGCAGCAGCCTGG + Intronic
1142493287 17:292594-292616 CGGCTGGGGCAGCAGGAGCCCGG - Intronic
1142592239 17:1011386-1011408 CACCTGAACCAGCAGGAGCAGGG + Intronic
1143509762 17:7388951-7388973 TACCTGTGGAAGCAGGAGGGTGG - Exonic
1143696699 17:8625812-8625834 CAGCAGTGGCAGCAGCATCTGGG - Intronic
1144137754 17:12314615-12314637 CACCAGTGGCAGCAGCAGGAGGG + Intergenic
1144373664 17:14617690-14617712 CACCTATGGGTGAAGGAGCTGGG + Intergenic
1144445388 17:15322623-15322645 AACCTGTGGGAGCAGGGTCTGGG - Intronic
1144674761 17:17154690-17154712 CATCTGTGTCAGCAGGCACTTGG + Intronic
1144833292 17:18143602-18143624 CTGCTGTGGGAGCAGGAGGTGGG + Exonic
1144876242 17:18398939-18398961 CACCAAGGGCAGCAGGAGCCTGG - Intergenic
1145155986 17:20545481-20545503 CACCAAGGGCAGCAGGAGCCTGG + Intergenic
1145248953 17:21287045-21287067 CAGCTGTGACAGGCGGAGCTAGG + Intronic
1145272192 17:21410654-21410676 CACCTGGGACTGCAGGGGCTTGG + Intronic
1145732112 17:27198661-27198683 CATCAGAGGTAGCAGGAGCTGGG - Intergenic
1146227555 17:31079908-31079930 CATCAGAGGTAGCAGGAGCTGGG + Intergenic
1146264769 17:31445118-31445140 CACCATCTGCAGCAGGAGCTTGG - Intronic
1146806402 17:35868411-35868433 CAGGTGTGGGAGCAGAAGCTGGG + Intronic
1146843450 17:36169549-36169571 CACCGATGGCAGCAGGAGCCCGG + Intronic
1146855759 17:36257487-36257509 CACCGATGGCAGCAGGAGCCTGG + Intronic
1146864862 17:36330888-36330910 CACCGATGGCAGCAGGAGCCCGG - Intronic
1146871665 17:36381398-36381420 CACCGATGGCAGCAGGAGCCCGG + Intronic
1146879024 17:36432480-36432502 CACCGATGGCAGCAGGAGCCCGG + Intronic
1146882965 17:36453626-36453648 CACCGATGGCAGCAGGAGCCCGG + Intergenic
1146948243 17:36888689-36888711 CCCCTGGGGCAGCTGAAGCTGGG - Intergenic
1147067721 17:37931482-37931504 CACCGATGGCAGCAGGAGCCCGG - Intronic
1147074551 17:37982022-37982044 CACCGATGGCAGCAGGAGCCCGG + Intronic
1147079252 17:38011037-38011059 CACCGATGGCAGCAGGAGCCCGG - Intronic
1147086074 17:38061561-38061583 CACCGATGGCAGCAGGAGCCCGG + Intronic
1147095191 17:38134979-38135001 CACCGATGGCAGCAGGAGCCCGG - Intergenic
1147102019 17:38185526-38185548 CACCGATGGCAGCAGGAGCCCGG + Intergenic
1147175733 17:38655097-38655119 CACCTGGGGGAGGAGCAGCTGGG + Intergenic
1148022481 17:44562585-44562607 CACCTGTGGCACCTGGGCCTGGG + Intergenic
1148779433 17:50113112-50113134 CACCTGGGGCAAAAGGAGCCTGG - Intronic
1148957282 17:51364345-51364367 CACCTGGGGCAGAAGCACCTGGG + Intergenic
1149656302 17:58311142-58311164 CACCTGCAGCAGCTGCAGCTGGG + Exonic
1149846610 17:60012036-60012058 CACCGATGGCAGCAGGAGCCCGG + Intergenic
1149868528 17:60163464-60163486 CACCGGGGACAGCAGGAGCCCGG - Intronic
1150084957 17:62268611-62268633 CACCGATGGCGGCAGGAGCCCGG + Intergenic
1151696624 17:75721340-75721362 CACCTGTCGGGGCAGGAGCTGGG - Intronic
1152275557 17:79354654-79354676 CACCAGAGGCAGCAGGAACCTGG - Intronic
1152581583 17:81167709-81167731 CACCTGGGGCAGAAGGAGACAGG + Intergenic
1152710773 17:81869659-81869681 CACCAGTGGAAGTAGGGGCTGGG + Intronic
1152822883 17:82446091-82446113 CACCTGTGGCTTCAGGGGTTTGG - Intronic
1153277215 18:3379100-3379122 GAACTGTGGCTGCAGTAGCTAGG + Intergenic
1153322472 18:3786624-3786646 CACCTGTGACTGCAGGTGATTGG - Intronic
1154334508 18:13455071-13455093 CACCTGTATGTGCAGGAGCTGGG + Intronic
1154952850 18:21226846-21226868 CACCTGTGGTGGCAGGAACCCGG + Intergenic
1155911682 18:31511374-31511396 CCCCAGTGGCAGGAGGAGCGGGG + Intronic
1157112900 18:44837713-44837735 GACCTGAGTCAGGAGGAGCTGGG - Intronic
1158210822 18:55047816-55047838 CATGTTAGGCAGCAGGAGCTGGG + Intergenic
1158388173 18:57018519-57018541 CACATGTGGCAGCATCAGCCAGG - Intronic
1159709566 18:71739621-71739643 CACCTGTGGTTGCAGCTGCTTGG - Intronic
1160439998 18:78882559-78882581 CACCAGAGACAGCAGGACCTGGG - Intergenic
1160882591 19:1328302-1328324 TCCCTGTGTGAGCAGGAGCTGGG - Intergenic
1161185967 19:2921031-2921053 GACCTGCTGCAGCAGGAGCTAGG - Intergenic
1161217945 19:3104145-3104167 CAGCCCTGACAGCAGGAGCTGGG - Intronic
1161569681 19:5023644-5023666 GACCAGTGGGAGCAGGAGGTGGG + Intronic
1162464429 19:10831598-10831620 CACCTCTGGCAGCCGAGGCTGGG - Exonic
1162792977 19:13072522-13072544 CTCCTCTGGGAGCTGGAGCTGGG + Intronic
1162794103 19:13077900-13077922 CACCTCTGGCACCAGAAGCAGGG + Intronic
1162898272 19:13778407-13778429 AACCTGTGGAGGCAGGACCTGGG - Exonic
1163111020 19:15161058-15161080 CGCCAGTGGCAGCAGGAACGAGG + Exonic
1163273592 19:16268808-16268830 CAGATGTGGCAACAGGAGCTGGG + Intergenic
1163602150 19:18255602-18255624 CAGCTGTGGAACCAGGAGCAGGG - Intergenic
1164402292 19:27910622-27910644 GACCTATGGCAACAGGAGGTTGG + Intergenic
1164534703 19:29076470-29076492 GCTCTGTGGGAGCAGGAGCTGGG - Intergenic
1165436159 19:35796746-35796768 CATCTGTGGCGGCAGGATCAAGG - Intergenic
1165471519 19:36007198-36007220 CACCTGTGCCTGCTGGGGCTGGG - Exonic
1166341487 19:42140139-42140161 GACCTGTGGGAGCAGGCGCCTGG + Intronic
1166390607 19:42407040-42407062 GACCTGGGTGAGCAGGAGCTGGG + Intronic
1166785794 19:45365960-45365982 CACCTGTGGCCGCAGCTACTCGG - Intronic
1168079568 19:53999616-53999638 CACCTCTGCCAGCAGGAGAGAGG - Exonic
1168288158 19:55344659-55344681 CAGCTGTGGTGGCAGGAGCAGGG + Intronic
1168393952 19:56032678-56032700 CACCTGCGGCAGCTGGACCTGGG + Exonic
925354389 2:3227770-3227792 CAGCTGGAGCAGCAGCAGCTGGG - Intronic
925377764 2:3400464-3400486 CACCTGAGGCAGGGGCAGCTGGG - Intronic
925385586 2:3459648-3459670 ACCGTGTGGCAGCAGGTGCTAGG + Intronic
925601467 2:5612374-5612396 CACCTGAGGGACCAGAAGCTAGG + Intergenic
925843408 2:8013186-8013208 AACATGTATCAGCAGGAGCTGGG + Intergenic
925970952 2:9106179-9106201 CACCTGGGGCAGCAGGTACCTGG - Intergenic
926712051 2:15889728-15889750 GTTCTGTGGGAGCAGGAGCTAGG + Intergenic
928374950 2:30766421-30766443 AACCTGTCCCAGCAGCAGCTGGG + Intronic
928912812 2:36439921-36439943 CACCTGTTGCTTCAGCAGCTTGG - Intronic
930020701 2:47000488-47000510 AACCTGACGCAGCAGGAGCTCGG + Intronic
931678184 2:64718753-64718775 CTTCTGTGGCAGCAGCATCTGGG + Intronic
932133836 2:69211368-69211390 CAACTGTGCCAGCAGGTGTTGGG + Intronic
932399417 2:71469470-71469492 CATCTGTGCCATGAGGAGCTGGG - Intronic
932579262 2:72982998-72983020 CACCTGTGGCAGCTTGTCCTGGG - Intronic
932581264 2:72994083-72994105 CCCCTGTGGCATAAGGAGGTGGG - Intronic
933332491 2:80911921-80911943 CACCTCTGGCAGCAGGATCATGG - Intergenic
933892418 2:86783983-86784005 CTCCTGTGGAAGCAGGGCCTGGG - Intergenic
934753763 2:96810973-96810995 CACTGGGTGCAGCAGGAGCTGGG + Exonic
935293702 2:101630401-101630423 CGCCTTTGCCAGCAGGAACTTGG + Intergenic
935591979 2:104853054-104853076 TCCCTGTGGCAGCAGGAGCCGGG - Intergenic
936400806 2:112163143-112163165 CAGCCGTGGCAGCCTGAGCTGGG - Intronic
936519193 2:113201224-113201246 GACCTGTGGGAGGAGCAGCTGGG + Exonic
936876239 2:117193051-117193073 ACCCTGTGGCAGCAGGGACTAGG - Intergenic
937941957 2:127293317-127293339 CACGTGTGGCGGCCGGACCTGGG - Intronic
938565368 2:132514054-132514076 GTCCTGTGGCAGCAGGAGGGTGG + Intronic
940396461 2:153196876-153196898 GAGCAGTGGCAGCAGGAGCAGGG - Intergenic
940456871 2:153912896-153912918 CAACAGTGGCAGCAGCAGCATGG + Intronic
940866099 2:158819219-158819241 CACCTGTGGTCCCAGCAGCTTGG - Intronic
941145687 2:161841366-161841388 AACCTGTGTCAGCAGGGGCATGG - Intronic
942139891 2:172967384-172967406 CATCTGTGACAGCAGCAGCATGG - Exonic
942461380 2:176171110-176171132 CACCCCTGGCAGCAGAGGCTGGG + Intronic
943394919 2:187322276-187322298 CACCAGTGCAAGAAGGAGCTGGG - Intergenic
946280905 2:218664794-218664816 TACCAGAGGCAGCAGGAGCGGGG - Exonic
947919334 2:233855618-233855640 ACCCTGGGGCAGCAGGACCTTGG - Intergenic
948240562 2:236429642-236429664 AACCTGTGGAGGCAGTAGCTGGG + Intronic
948904514 2:240972259-240972281 TCCCTGTGGCTGCAGGATCTTGG - Intronic
1169147279 20:3261015-3261037 CACCTGTCACAGAAGGAACTGGG + Intronic
1170573129 20:17643615-17643637 CTCCTGTGGCTGCAGGAGTGTGG - Intronic
1171046413 20:21812265-21812287 CCTCTGAGGGAGCAGGAGCTCGG + Intergenic
1171075872 20:22122573-22122595 CACCAGTGGCTACATGAGCTGGG - Intergenic
1171515902 20:25734876-25734898 CACCAGTGGCAGGATGATCTGGG - Intergenic
1173473255 20:43339570-43339592 CACCTGTGGCTACAGGTGCATGG + Intergenic
1174449238 20:50609525-50609547 CAGCAGGGGCAGCAAGAGCTGGG - Intronic
1175373148 20:58506209-58506231 CACCTCTGGAAGCAGGAATTTGG + Intronic
1175740291 20:61415206-61415228 GACCTGCCGAAGCAGGAGCTCGG + Intronic
1175963622 20:62649251-62649273 CTCCTGTGACAGCTGCAGCTGGG - Intronic
1176214847 20:63943133-63943155 CAGCTCTGCCAGCAGGAACTGGG - Intronic
1176275848 20:64268397-64268419 CCCATGAGGCAGCAGGCGCTTGG - Intronic
1178297465 21:31422456-31422478 CATCTGTTGCATCAGGATCTTGG - Intronic
1178718494 21:34988210-34988232 CCCCAGGGGCACCAGGAGCTGGG - Intronic
1178846231 21:36176297-36176319 CAACTGTGGCAGCAGCACCAAGG - Intronic
1179433829 21:41345612-41345634 CACTTGTGGCACCAGGGCCTGGG - Intronic
1179906541 21:44425923-44425945 CCCCTGTGGCTGCAGTGGCTGGG - Intronic
1180002461 21:45001553-45001575 CAGCCGTGGCAGCAGGGGGTGGG + Intergenic
1180090970 21:45533697-45533719 CACCTGGGGCAGCACGAGTGGGG - Intronic
1180138922 21:45879108-45879130 CACCTGTGGTTGCAGCTGCTGGG - Intronic
1180141839 21:45897889-45897911 CACCTGAGGCAGGAAGAACTGGG - Intronic
1180875842 22:19174985-19175007 GCCCTGGGGCAGCAGGAGGTGGG - Intergenic
1181886109 22:26023584-26023606 CAGCAGTGGCAGTGGGAGCTAGG + Intronic
1181999476 22:26908625-26908647 CACCTGTGGCATGAGGAAGTTGG + Intergenic
1182494136 22:30694647-30694669 CACCTGTGGGCGGAAGAGCTTGG - Intronic
1183471025 22:38006807-38006829 CAGATGTGGAAGCTGGAGCTCGG - Intronic
1183475068 22:38031603-38031625 CACCTGTGACATCAGGCGCCTGG - Intronic
1183510488 22:38231748-38231770 CTCCTGCCGCAGCAGTAGCTGGG - Intronic
1183710576 22:39501184-39501206 CAGCTGAGTGAGCAGGAGCTGGG - Intronic
1183959425 22:41402390-41402412 CAGCTCTGTCATCAGGAGCTAGG + Intergenic
1184015079 22:41779949-41779971 CACCTGTGGCTACAGGAGCTGGG - Intronic
1184841953 22:47057277-47057299 CTCCCGTGGAAGGAGGAGCTTGG - Intronic
1185068643 22:48644441-48644463 CACCATGGGCAGAAGGAGCTGGG + Intronic
1185382587 22:50516969-50516991 GCCCCGTGGCGGCAGGAGCTGGG + Intronic
949743507 3:7263412-7263434 CAGCAGTGGCAGCAGCAGCATGG + Intronic
950720245 3:14877343-14877365 CACGTCTGGCAGGAGGGGCTGGG + Intronic
952269302 3:31816644-31816666 CATCTGTGGCTGCAGCACCTTGG + Intronic
952834861 3:37594059-37594081 CACGTGTGGCAGCAGCAGCGTGG - Intronic
952879450 3:37974407-37974429 CACCTGTGGCTGGTGGCGCTGGG - Intronic
953224314 3:41002440-41002462 AATTTGTTGCAGCAGGAGCTGGG - Intergenic
953863346 3:46563848-46563870 CACCTCTGTCTGCAGGGGCTTGG - Intronic
953984019 3:47427648-47427670 CAGCTCTGGGATCAGGAGCTTGG - Exonic
954252497 3:49378744-49378766 CAGCTGTGGTGGCAGGAGCCTGG - Intronic
954715309 3:52523896-52523918 CACCTGTGGCGGCAGGCGTGGGG + Exonic
954895591 3:53972505-53972527 CCACTGTGGCTGCAGGAGATAGG - Intergenic
956608136 3:71094024-71094046 CACCTTTGGGAGAAGGAGCTTGG - Intronic
957593186 3:82226067-82226089 GATCTGTGGCAGCTGGTGCTGGG + Intergenic
958539108 3:95447242-95447264 AACATGTGTCAGCAGGAGCAGGG - Intergenic
959622219 3:108410825-108410847 CACCAGCTGCAGCTGGAGCTCGG - Exonic
961165940 3:124763920-124763942 CACCTCTGGAAGGAGGAGTTGGG + Intronic
961203179 3:125060468-125060490 CACCTGAGGCAGGAGGAAGTGGG + Intergenic
962702124 3:138010166-138010188 CACCTTCGGCAGCAGGAGGGCGG + Exonic
962774750 3:138649193-138649215 CACCAGTGGCAGCAGCAGAAGGG + Intergenic
962889918 3:139662596-139662618 CATCAGAGGAAGCAGGAGCTAGG - Intronic
962977537 3:140458626-140458648 CATCTGAGGCAGCAGGAGTGGGG - Intronic
963289994 3:143477770-143477792 CAGCTGAGGAAGCAGGTGCTGGG + Intronic
963905164 3:150767566-150767588 CACCTGTGGCACCTTGACCTTGG - Intergenic
964426706 3:156561671-156561693 CAGCTGTGGCTGGAGCAGCTGGG - Intergenic
964552038 3:157895715-157895737 CACCTGTGACAGAAGTAGGTAGG - Intergenic
965521454 3:169671457-169671479 AGCCTGTGGCAGCAGGACCTGGG + Intergenic
966313155 3:178616521-178616543 CACCCCAGGCAGCAGCAGCTTGG - Intronic
967255901 3:187591545-187591567 CAGCTGTGGCAGAAAGAGCAGGG - Intergenic
967635819 3:191801682-191801704 CAGCTGTGGCAGTAGAAGTTGGG - Intergenic
968053789 3:195675324-195675346 AACCTGTGGCGTCAGGAGCGAGG - Intergenic
968262120 3:197333974-197333996 CAGCAGCAGCAGCAGGAGCTAGG + Intergenic
968500268 4:946727-946749 CGCCTGTGGGAGCCGGGGCTGGG - Intronic
968967850 4:3778339-3778361 CAGCTGCAGCAGCAGCAGCTGGG + Intergenic
969567162 4:7985348-7985370 CACCTGGGACAGCAGGTTCTAGG - Intronic
971127110 4:23766015-23766037 CACCGGTTGCAGAAGCAGCTGGG - Intronic
971688221 4:29798921-29798943 TACCTGAGGCTGCAGGAGCATGG - Intergenic
972205678 4:36769240-36769262 CACATATGGCTTCAGGAGCTAGG + Intergenic
972875373 4:43352281-43352303 CCCCTGTGGGTGCTGGAGCTTGG - Intergenic
973027607 4:45292872-45292894 CACATGTGCCAGCAGCAGCAGGG + Intergenic
978237556 4:106477868-106477890 CACTTGTGGAAACAGCAGCTGGG - Intergenic
981569469 4:146136225-146136247 CACCTGGGGCATCAGGGGCCTGG - Intergenic
981920395 4:150079117-150079139 CTCCGGGGGCAGCAGCAGCTCGG + Exonic
982074450 4:151724581-151724603 CACGTTTGGCTGCAGGAGCATGG - Intronic
982436555 4:155387611-155387633 CACGTGTGGTGGGAGGAGCTGGG - Intergenic
984993387 4:185403859-185403881 CTCCTGCCTCAGCAGGAGCTGGG - Intronic
985550951 5:533387-533409 CACCTGTGGCGGCAGGAGGAGGG + Intergenic
985718570 5:1476552-1476574 GACCTGCTGCAGCAGGAGCCTGG + Intronic
985974430 5:3405064-3405086 AACCTGAGGCAGAAGGAGATTGG + Intergenic
985986497 5:3520851-3520873 CAGCTGCTGCAGCAGGAGCCAGG + Intergenic
986169521 5:5304264-5304286 CACCTGTTGCTGCAGGAGGCTGG + Intronic
986313863 5:6573211-6573233 CACCTGTGGCAGCAGTGCCCAGG - Intergenic
986447271 5:7832317-7832339 GACCAGCAGCAGCAGGAGCTGGG - Intronic
987061544 5:14248519-14248541 CACCTACGGCAGCAGGTGCAGGG - Intronic
987169090 5:15234549-15234571 TAGCTGGGTCAGCAGGAGCTGGG - Intergenic
987709064 5:21486119-21486141 TACCTATGGCAGGAGCAGCTGGG + Intergenic
988750548 5:34188034-34188056 TACCTGTGGCAGGAGCAGCTGGG - Intergenic
991685869 5:69182048-69182070 CACCTGTGCCAGCAGGGGCATGG - Intergenic
991735689 5:69629948-69629970 TACCTATGGCAGGAGCAGCTGGG - Intergenic
991738814 5:69651232-69651254 TACCTATGGCAGGAGCAGCTGGG - Intergenic
991787952 5:70212923-70212945 TACCTATGGCAGGAGCAGCTGGG - Intergenic
991790389 5:70230973-70230995 TACCTATGGCAGGAGCAGCTGGG - Intergenic
991812180 5:70485587-70485609 TACCTATGGCAGGAGCAGCTGGG - Intergenic
991815138 5:70506064-70506086 TACCTATGGCAGGAGCAGCTGGG - Intergenic
991818274 5:70527349-70527371 TACCTATGGCAGGAGCAGCTGGG - Intergenic
991838611 5:70780261-70780283 TACCTATGGCAGGAGCAGCTGGG + Intergenic
991880398 5:71213287-71213309 TACCTATGGCAGGAGCAGCTGGG - Intergenic
991882837 5:71231313-71231335 TACCTATGGCAGGAGCAGCTGGG - Intergenic
992769061 5:80030323-80030345 CACCTGTGGCCCCAGGAACTTGG - Intronic
994421190 5:99527462-99527484 TACCTATGGCAGGAGCAGCTGGG + Intergenic
994485853 5:100386852-100386874 TACCTATGGCAGGAGCAGCTGGG - Intergenic
996806177 5:127456796-127456818 CACCTGTGGAATAAGGGGCTTGG + Intronic
997199982 5:132004079-132004101 CACTTGTGGCAGCAGGAGTGTGG - Intronic
997434390 5:133863986-133864008 CAGCTGTGGCAGCTGGAGGAAGG - Intergenic
997516440 5:134493166-134493188 CAGGTGTGCCAGCAGGATCTGGG - Intergenic
998130023 5:139647158-139647180 CGCCTGTGGCTGCAGGCGCCCGG + Intergenic
998725271 5:145005465-145005487 CTCCTGTGCCAGCAGGCTCTTGG + Intergenic
999062806 5:148654127-148654149 CAGCGGCGGCAGCAGAAGCTCGG - Exonic
999110061 5:149111565-149111587 CACCTGTAGCCCCAGGTGCTTGG + Intergenic
999269496 5:150288608-150288630 CTGCTGAGGCAGCAGGAGCACGG - Intronic
1000572733 5:162935494-162935516 CAGCTGTGGTAGCAGCAGGTTGG + Intergenic
1002257304 5:177967618-177967640 CACATCTGACAACAGGAGCTGGG + Intergenic
1002399260 5:178982090-178982112 CACCTGGGGAAGCGGGAGCCGGG + Intronic
1002419256 5:179137172-179137194 CACATGAGGCAGCAGCTGCTGGG + Intronic
1002493492 5:179596608-179596630 CACAAGCTGCAGCAGGAGCTGGG + Exonic
1002935688 6:1670163-1670185 TCCCTGTGGCACCAGCAGCTCGG + Intronic
1003034829 6:2633396-2633418 CTCCTCTGTCTGCAGGAGCTGGG - Intronic
1003105508 6:3211957-3211979 CTCCTGTGGGAGGAAGAGCTAGG + Intergenic
1003170642 6:3719479-3719501 CACCCTTGGCTGCAGGGGCTTGG - Intergenic
1003374159 6:5559277-5559299 CACCTGTGGTACCAGCTGCTTGG + Intronic
1003672454 6:8171809-8171831 CACAGGAGGCAGCAGGAGATGGG + Intergenic
1004409527 6:15367789-15367811 CTCCTGGGGAAGCAGGAGTTGGG - Intronic
1005548620 6:26894339-26894361 TACCTATGGCAGGAGCAGCTGGG - Intergenic
1006093070 6:31639572-31639594 CAGCTAAGGCAGCCGGAGCTCGG - Exonic
1006097295 6:31664080-31664102 CGCATGAGGCAGGAGGAGCTGGG - Exonic
1007373813 6:41443220-41443242 CACCTGGAGAAACAGGAGCTGGG + Intergenic
1007409425 6:41653395-41653417 CACCTGTGGCTCCTGCAGCTCGG + Exonic
1008302588 6:49859355-49859377 CATCTCTGGCAGCAGCAGCTAGG - Intronic
1008559003 6:52704934-52704956 CACCTCTGACAGCATGATCTTGG - Intergenic
1009019375 6:57935446-57935468 TACCTATGGCAGGAGCAGCTGGG - Intergenic
1015224235 6:130838318-130838340 CACCTGTAGCTACAGGAGCAAGG - Intergenic
1015878916 6:137851454-137851476 CACCAGCAGCAGCAGCAGCTGGG + Intergenic
1015905054 6:138107886-138107908 CACCTGTGTCAGCAGGGGTCAGG - Intergenic
1017758380 6:157549121-157549143 CTCCTCAGGCAGCAGGAGGTGGG - Intronic
1019729503 7:2622518-2622540 CAGCTGGGGCAGGAGGAGCTGGG - Intergenic
1019729508 7:2622533-2622555 CAGCTGGGGCAGGAGCAGCTGGG - Intergenic
1019729512 7:2622548-2622570 CAGCTGGGGCAGGAGCAGCTGGG - Intergenic
1019729528 7:2622608-2622630 GAGCTGGGGCAGGAGGAGCTGGG - Intergenic
1020376761 7:7495988-7496010 ATCCTGTGGCAGGAGGAGCAAGG - Intronic
1022360102 7:29649443-29649465 CACCAGGGGCTGCAGGCGCTGGG + Intergenic
1022480765 7:30741598-30741620 CACCTGCAGGAACAGGAGCTTGG + Intronic
1023401300 7:39794169-39794191 CCACTGAGGCAGGAGGAGCTGGG - Intergenic
1023603723 7:41907911-41907933 CCACTGTGACAGCAGGAGCAGGG + Intergenic
1023984931 7:45088850-45088872 CGCCTCGGGCAGCAGCAGCTCGG + Exonic
1024134841 7:46396063-46396085 CATGTGTGGAAGCTGGAGCTGGG + Intergenic
1024229399 7:47352795-47352817 CACCTGTGGACCCAGGGGCTGGG - Intronic
1026588145 7:71674469-71674491 CACCTGTGGTAGCAGCTACTAGG - Intronic
1026935538 7:74253047-74253069 CACCTGTTGCTGCTGGAGCACGG + Intronic
1027270320 7:76515268-76515290 GGCCTGTGGGTGCAGGAGCTGGG - Exonic
1027946325 7:84749556-84749578 AGCCTGAGTCAGCAGGAGCTAGG - Intergenic
1029278575 7:99422488-99422510 CTCCTGTATCAGCAGGAGCAGGG - Intronic
1030317337 7:108129201-108129223 CACCTGTGGTTCTAGGAGCTGGG - Intronic
1032312742 7:130803467-130803489 GACCTCAGACAGCAGGAGCTGGG + Intergenic
1032700548 7:134374892-134374914 CAGCTGTGGTAGCTGGGGCTTGG + Intergenic
1033472164 7:141659950-141659972 CCACAGTGGCAGCAGAAGCTAGG - Exonic
1033806256 7:144957361-144957383 CAGCTGTGGCATCTGGTGCTGGG + Intergenic
1033885840 7:145943502-145943524 CAGCAGTGGCAGCAGTAGATTGG - Intergenic
1033895736 7:146066925-146066947 CACCTGTGGCCCCAGCTGCTCGG + Intergenic
1033985551 7:147221487-147221509 CACCTGAGACAGCAGAAGCATGG - Intronic
1034330046 7:150274640-150274662 CACCTGAGGACGCAGGGGCTGGG + Intronic
1034668009 7:152835221-152835243 CACCTGAGGACGCAGGGGCTGGG - Intronic
1035184286 7:157113727-157113749 CACCTGTGGCAGGAGGGACTTGG + Intergenic
1035686674 8:1528486-1528508 CACCAGGAGCAGCAGCAGCTAGG + Intronic
1035723069 8:1806903-1806925 CACCTGTGGTCCCAGCAGCTTGG + Intergenic
1036528400 8:9556436-9556458 GGCCTGGGGCAGCAGGACCTGGG + Exonic
1036758546 8:11490392-11490414 CAGCTCTGGCAGCAGAAGATGGG - Intergenic
1036942556 8:13065545-13065567 CACCTCTGAGAGAAGGAGCTAGG - Intergenic
1037945625 8:22987804-22987826 AACCTGTGGCAGCCAGATCTGGG + Intronic
1037946495 8:22992906-22992928 CACCTCTGCCAGCAGGGACTAGG + Intronic
1038157160 8:25001129-25001151 CACGGCTGGCACCAGGAGCTCGG - Intergenic
1038962729 8:32539281-32539303 TAACTCTGGTAGCAGGAGCTGGG + Intronic
1039587616 8:38719978-38720000 CACCTGGGCCAGCAGCTGCTGGG + Intergenic
1042128899 8:65566917-65566939 CACCTAAGGAAGCAGCAGCTAGG - Intergenic
1042504639 8:69547166-69547188 CTACTGTGGCAGGAGGAGGTGGG + Intronic
1043161557 8:76853252-76853274 CAACTTTGCCAGCAGCAGCTCGG + Exonic
1046348088 8:112963252-112963274 AACCTATGGTAGCAGCAGCTGGG - Intronic
1046639545 8:116712194-116712216 CATCTGTGGTAGAAGGAGTTTGG - Intronic
1047101077 8:121676426-121676448 CTCCAGTGGCAGCAGCAGCCAGG + Intergenic
1048331453 8:133473551-133473573 CCCCTGTAGCAGCAGTTGCTGGG - Intronic
1049037284 8:140086502-140086524 CCCCAGAGGCAGCAGGAGCTGGG - Intronic
1049073476 8:140375107-140375129 CACCTATGGCACAAGGAGCCGGG + Intronic
1049149721 8:141026836-141026858 GCCCTGAGGCAGCAGGAGCCAGG + Intergenic
1049448078 8:142640861-142640883 AATCTGTGGGACCAGGAGCTGGG - Intergenic
1049688667 8:143949406-143949428 CACCTGTACCAGCAGGACCCAGG - Intronic
1049935668 9:499468-499490 GAACTGTGGCAGCAGGAATTGGG - Intronic
1051653359 9:19353008-19353030 CACCTGTGGTAGCAGTTACTAGG + Intronic
1052791389 9:32878321-32878343 CACAGGTGGCAGCAGGGGCAGGG - Intergenic
1053279145 9:36806114-36806136 CTCCTGTGGGGGTAGGAGCTGGG - Intergenic
1053548259 9:39046644-39046666 CACCTGTTGCAGGAGGTGCTTGG - Intergenic
1053564738 9:39237139-39237161 CACCGGAGGCACCAGCAGCTAGG - Intronic
1053812379 9:41866682-41866704 CACCTGTTGCAGGAGGTGCTTGG - Intergenic
1053830518 9:42075040-42075062 CACCGGAGGCACCAGCAGCTAGG - Intronic
1054132413 9:61381895-61381917 CACCGGAGGCACCAGCAGCTAGG + Intergenic
1054600042 9:67112415-67112437 CACCGGAGGCACCAGCAGCTAGG + Intergenic
1054618216 9:67320757-67320779 CACCTGTTGCAGGAGGTGCTTGG + Intergenic
1054870549 9:70044280-70044302 CCCCGGGGGCAGCAGGAGCGGGG - Intronic
1055357442 9:75451878-75451900 TACCTGAGGAGGCAGGAGCTTGG + Intergenic
1056579543 9:87880830-87880852 CCCCTGCAGCAGCAGGAGCAAGG + Intergenic
1056601811 9:88052766-88052788 CAGCTGTGGCAGCTGGGGGTGGG - Intergenic
1056858778 9:90160472-90160494 CCCCTGTGACAGCAGGATGTTGG + Intergenic
1056947110 9:91007314-91007336 CAGCTGGGGCAGAAGCAGCTGGG - Intergenic
1057146539 9:92763125-92763147 ACCCTGGGCCAGCAGGAGCTGGG - Intronic
1057213719 9:93216666-93216688 CACCTGTGGTATCAGCTGCTCGG + Intronic
1058405074 9:104663569-104663591 CTCCTGCCCCAGCAGGAGCTGGG - Intergenic
1058686821 9:107487770-107487792 CAATTCTGGCCGCAGGAGCTCGG + Exonic
1058783785 9:108365634-108365656 CACCCCTTCCAGCAGGAGCTTGG + Intergenic
1058931404 9:109722920-109722942 CACATGAGGCAGGAGGTGCTTGG - Intronic
1059068640 9:111110970-111110992 AGCCTGTGGCTGCAGGAACTTGG + Intergenic
1060518560 9:124280916-124280938 CACCTGTAGCACCAGCTGCTTGG - Intronic
1061496528 9:130977954-130977976 CAACTCTGGCAGCCTGAGCTGGG + Intergenic
1061939047 9:133874339-133874361 CTGCTGTGGCTGCAGGAGCCAGG + Intronic
1062065714 9:134525202-134525224 GTCCTGAGGCAGCAGGAGCCAGG - Intergenic
1062230774 9:135480246-135480268 CACCTGGGGCTCCAGGAGCGCGG - Intronic
1062263441 9:135675192-135675214 CACCTGTGGCTCCAGGAGTATGG + Intergenic
1062452610 9:136621874-136621896 CACCTGCGGCGGCCGGCGCTGGG - Intergenic
1062593678 9:137287728-137287750 CACCTGTGGCCCCAGCTGCTTGG - Intergenic
1062606075 9:137349446-137349468 CTCCTGGTGCAGCAGGTGCTGGG - Exonic
1185543926 X:926554-926576 CACCTGGAGCCCCAGGAGCTGGG - Intergenic
1187069060 X:15869824-15869846 CACCTGTGGCCGCAGCTACTTGG + Intergenic
1187446974 X:19369013-19369035 CTCCTCTGGGAGCAGGCGCTGGG - Intronic
1187476295 X:19614084-19614106 CACCTGAGGCAGCAGGGACTAGG - Intronic
1187846142 X:23540345-23540367 CACCCCTGGCAGGAGCAGCTTGG + Intergenic
1188040694 X:25367279-25367301 GACCTCTGGCAGCAGCAGCATGG - Intergenic
1189558046 X:42165715-42165737 CAGCAGTGGCAGCAGCAGCACGG + Intergenic
1190642502 X:52494561-52494583 CACCTGTAGTAGCAGGGACTGGG + Intergenic
1190645171 X:52518306-52518328 CACCTGTAGTAGCAGGGACTGGG - Intronic
1191178783 X:57537195-57537217 CACCTGTTGCAGCAGCAGCTGGG + Intergenic
1192252598 X:69425224-69425246 AACCTGAGGCAGCTGGAGCCTGG + Intergenic
1192589299 X:72346660-72346682 CATTTCAGGCAGCAGGAGCTGGG + Intronic
1194556521 X:95367447-95367469 CATCTGTGAGTGCAGGAGCTGGG + Intergenic
1195630162 X:107047503-107047525 CACCTGTGGGAGGCGGAGGTGGG - Intergenic
1197833799 X:130673031-130673053 CACCTGTGGCAGAAGCAGATCGG - Intronic
1198299161 X:135317647-135317669 CACCTGTGGTAGAGGCAGCTGGG + Intronic
1199649920 X:149940264-149940286 GAGCTGTGGGAGGAGGAGCTGGG + Intergenic
1200057571 X:153469770-153469792 CTCTTGTGGCAGCAGGACCTAGG + Intronic
1200292627 X:154886880-154886902 CAGCTGGGGCAGCTGGAGCTGGG - Exonic
1200339471 X:155382620-155382642 CAGCTGGGGCAGCTGGAGCTGGG - Exonic
1200346999 X:155458073-155458095 CAGCTGGGGCAGCTGGAGCTGGG + Exonic
1200800737 Y:7385217-7385239 CACCTGTGGCTGCAGCTACTTGG + Intergenic