ID: 1123652061

View in Genome Browser
Species Human (GRCh38)
Location 15:22484212-22484234
Sequence TCCTGGAGCAGGGTTTTCAC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1123652056_1123652061 -7 Left 1123652056 15:22484196-22484218 CCAAAAGACTGGACCCTCCTGGA No data
Right 1123652061 15:22484212-22484234 TCCTGGAGCAGGGTTTTCACAGG No data
1123652046_1123652061 30 Left 1123652046 15:22484159-22484181 CCCAAGACAATTCTTCTTCCAGT 0: 130
1: 394
2: 410
3: 264
4: 747
Right 1123652061 15:22484212-22484234 TCCTGGAGCAGGGTTTTCACAGG No data
1123652051_1123652061 12 Left 1123652051 15:22484177-22484199 CCAGTGTGGCCCAGGGAAACCAA 0: 23
1: 354
2: 884
3: 838
4: 683
Right 1123652061 15:22484212-22484234 TCCTGGAGCAGGGTTTTCACAGG No data
1123652054_1123652061 2 Left 1123652054 15:22484187-22484209 CCAGGGAAACCAAAAGACTGGAC 0: 10
1: 116
2: 894
3: 994
4: 751
Right 1123652061 15:22484212-22484234 TCCTGGAGCAGGGTTTTCACAGG No data
1123652053_1123652061 3 Left 1123652053 15:22484186-22484208 CCCAGGGAAACCAAAAGACTGGA 0: 8
1: 132
2: 905
3: 1022
4: 794
Right 1123652061 15:22484212-22484234 TCCTGGAGCAGGGTTTTCACAGG No data
1123652047_1123652061 29 Left 1123652047 15:22484160-22484182 CCAAGACAATTCTTCTTCCAGTG 0: 141
1: 382
2: 397
3: 233
4: 394
Right 1123652061 15:22484212-22484234 TCCTGGAGCAGGGTTTTCACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1123652061 Original CRISPR TCCTGGAGCAGGGTTTTCAC AGG Intergenic
No off target data available for this crispr