ID: 1123655693

View in Genome Browser
Species Human (GRCh38)
Location 15:22515386-22515408
Sequence GGTTCTAAGAGACCAAAATC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1123655685_1123655693 28 Left 1123655685 15:22515335-22515357 CCTTGAATCTACTTATTTTCCCA No data
Right 1123655693 15:22515386-22515408 GGTTCTAAGAGACCAAAATCTGG No data
1123655691_1123655693 0 Left 1123655691 15:22515363-22515385 CCTAGCGTCTTTTATCGGGAAAT No data
Right 1123655693 15:22515386-22515408 GGTTCTAAGAGACCAAAATCTGG No data
1123655690_1123655693 1 Left 1123655690 15:22515362-22515384 CCCTAGCGTCTTTTATCGGGAAA No data
Right 1123655693 15:22515386-22515408 GGTTCTAAGAGACCAAAATCTGG No data
1123655687_1123655693 8 Left 1123655687 15:22515355-22515377 CCAAGAGCCCTAGCGTCTTTTAT No data
Right 1123655693 15:22515386-22515408 GGTTCTAAGAGACCAAAATCTGG No data
1123655686_1123655693 9 Left 1123655686 15:22515354-22515376 CCCAAGAGCCCTAGCGTCTTTTA No data
Right 1123655693 15:22515386-22515408 GGTTCTAAGAGACCAAAATCTGG No data
1123655684_1123655693 29 Left 1123655684 15:22515334-22515356 CCCTTGAATCTACTTATTTTCCC No data
Right 1123655693 15:22515386-22515408 GGTTCTAAGAGACCAAAATCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1123655693 Original CRISPR GGTTCTAAGAGACCAAAATC TGG Intergenic
No off target data available for this crispr