ID: 1123655764

View in Genome Browser
Species Human (GRCh38)
Location 15:22516237-22516259
Sequence CTACCTACGGGGAAATGGGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1123655764_1123655772 -3 Left 1123655764 15:22516237-22516259 CCTCCCCATTTCCCCGTAGGTAG No data
Right 1123655772 15:22516257-22516279 TAGTCATTGGTACTTGCTTTCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1123655764 Original CRISPR CTACCTACGGGGAAATGGGG AGG (reversed) Intergenic
No off target data available for this crispr