ID: 1123657824

View in Genome Browser
Species Human (GRCh38)
Location 15:22536648-22536670
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1123657824_1123657828 -1 Left 1123657824 15:22536648-22536670 CCCTCTGCTGTCTGGTTAGCAGG No data
Right 1123657828 15:22536670-22536692 GAGGTACAATTTGTACAGCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1123657824 Original CRISPR CCTGCTAACCAGACAGCAGA GGG (reversed) Intergenic
No off target data available for this crispr