ID: 1123657828

View in Genome Browser
Species Human (GRCh38)
Location 15:22536670-22536692
Sequence GAGGTACAATTTGTACAGCA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1123657820_1123657828 12 Left 1123657820 15:22536635-22536657 CCTACCAACCTTGCCCTCTGCTG No data
Right 1123657828 15:22536670-22536692 GAGGTACAATTTGTACAGCAAGG No data
1123657821_1123657828 8 Left 1123657821 15:22536639-22536661 CCAACCTTGCCCTCTGCTGTCTG No data
Right 1123657828 15:22536670-22536692 GAGGTACAATTTGTACAGCAAGG No data
1123657817_1123657828 26 Left 1123657817 15:22536621-22536643 CCTCTATAAAATCCCCTACCAAC No data
Right 1123657828 15:22536670-22536692 GAGGTACAATTTGTACAGCAAGG No data
1123657826_1123657828 -2 Left 1123657826 15:22536649-22536671 CCTCTGCTGTCTGGTTAGCAGGA No data
Right 1123657828 15:22536670-22536692 GAGGTACAATTTGTACAGCAAGG No data
1123657823_1123657828 4 Left 1123657823 15:22536643-22536665 CCTTGCCCTCTGCTGTCTGGTTA No data
Right 1123657828 15:22536670-22536692 GAGGTACAATTTGTACAGCAAGG No data
1123657818_1123657828 14 Left 1123657818 15:22536633-22536655 CCCCTACCAACCTTGCCCTCTGC No data
Right 1123657828 15:22536670-22536692 GAGGTACAATTTGTACAGCAAGG No data
1123657824_1123657828 -1 Left 1123657824 15:22536648-22536670 CCCTCTGCTGTCTGGTTAGCAGG No data
Right 1123657828 15:22536670-22536692 GAGGTACAATTTGTACAGCAAGG No data
1123657819_1123657828 13 Left 1123657819 15:22536634-22536656 CCCTACCAACCTTGCCCTCTGCT No data
Right 1123657828 15:22536670-22536692 GAGGTACAATTTGTACAGCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1123657828 Original CRISPR GAGGTACAATTTGTACAGCA AGG Intergenic
No off target data available for this crispr