ID: 1123666762

View in Genome Browser
Species Human (GRCh38)
Location 15:22614422-22614444
Sequence CAGGCTAGCACTTCCCCAAG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1123666759_1123666762 -8 Left 1123666759 15:22614407-22614429 CCCTTGACAACCAGTCAGGCTAG No data
Right 1123666762 15:22614422-22614444 CAGGCTAGCACTTCCCCAAGAGG No data
1123666760_1123666762 -9 Left 1123666760 15:22614408-22614430 CCTTGACAACCAGTCAGGCTAGC No data
Right 1123666762 15:22614422-22614444 CAGGCTAGCACTTCCCCAAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1123666762 Original CRISPR CAGGCTAGCACTTCCCCAAG AGG Intergenic
No off target data available for this crispr