ID: 1123667253

View in Genome Browser
Species Human (GRCh38)
Location 15:22617476-22617498
Sequence ACTTTGGGTGGGTGACTCCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1123667253_1123667269 11 Left 1123667253 15:22617476-22617498 CCCAGGAGTCACCCACCCAAAGT No data
Right 1123667269 15:22617510-22617532 GATTGGCGAGGGCAAGGACTGGG No data
1123667253_1123667264 0 Left 1123667253 15:22617476-22617498 CCCAGGAGTCACCCACCCAAAGT No data
Right 1123667264 15:22617499-22617521 CACCCTGGGGTGATTGGCGAGGG No data
1123667253_1123667263 -1 Left 1123667253 15:22617476-22617498 CCCAGGAGTCACCCACCCAAAGT No data
Right 1123667263 15:22617498-22617520 TCACCCTGGGGTGATTGGCGAGG No data
1123667253_1123667268 10 Left 1123667253 15:22617476-22617498 CCCAGGAGTCACCCACCCAAAGT No data
Right 1123667268 15:22617509-22617531 TGATTGGCGAGGGCAAGGACTGG No data
1123667253_1123667270 25 Left 1123667253 15:22617476-22617498 CCCAGGAGTCACCCACCCAAAGT No data
Right 1123667270 15:22617524-22617546 AGGACTGGGCTGCTTTCTGAAGG No data
1123667253_1123667273 30 Left 1123667253 15:22617476-22617498 CCCAGGAGTCACCCACCCAAAGT No data
Right 1123667273 15:22617529-22617551 TGGGCTGCTTTCTGAAGGGGTGG No data
1123667253_1123667267 5 Left 1123667253 15:22617476-22617498 CCCAGGAGTCACCCACCCAAAGT No data
Right 1123667267 15:22617504-22617526 TGGGGTGATTGGCGAGGGCAAGG No data
1123667253_1123667272 27 Left 1123667253 15:22617476-22617498 CCCAGGAGTCACCCACCCAAAGT No data
Right 1123667272 15:22617526-22617548 GACTGGGCTGCTTTCTGAAGGGG No data
1123667253_1123667262 -6 Left 1123667253 15:22617476-22617498 CCCAGGAGTCACCCACCCAAAGT No data
Right 1123667262 15:22617493-22617515 CAAAGTCACCCTGGGGTGATTGG No data
1123667253_1123667271 26 Left 1123667253 15:22617476-22617498 CCCAGGAGTCACCCACCCAAAGT No data
Right 1123667271 15:22617525-22617547 GGACTGGGCTGCTTTCTGAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1123667253 Original CRISPR ACTTTGGGTGGGTGACTCCT GGG (reversed) Intergenic
No off target data available for this crispr