ID: 1123667260

View in Genome Browser
Species Human (GRCh38)
Location 15:22617491-22617513
Sequence AATCACCCCAGGGTGACTTT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1123667260_1123667273 15 Left 1123667260 15:22617491-22617513 CCCAAAGTCACCCTGGGGTGATT No data
Right 1123667273 15:22617529-22617551 TGGGCTGCTTTCTGAAGGGGTGG No data
1123667260_1123667269 -4 Left 1123667260 15:22617491-22617513 CCCAAAGTCACCCTGGGGTGATT No data
Right 1123667269 15:22617510-22617532 GATTGGCGAGGGCAAGGACTGGG No data
1123667260_1123667268 -5 Left 1123667260 15:22617491-22617513 CCCAAAGTCACCCTGGGGTGATT No data
Right 1123667268 15:22617509-22617531 TGATTGGCGAGGGCAAGGACTGG No data
1123667260_1123667270 10 Left 1123667260 15:22617491-22617513 CCCAAAGTCACCCTGGGGTGATT No data
Right 1123667270 15:22617524-22617546 AGGACTGGGCTGCTTTCTGAAGG No data
1123667260_1123667274 16 Left 1123667260 15:22617491-22617513 CCCAAAGTCACCCTGGGGTGATT No data
Right 1123667274 15:22617530-22617552 GGGCTGCTTTCTGAAGGGGTGGG No data
1123667260_1123667271 11 Left 1123667260 15:22617491-22617513 CCCAAAGTCACCCTGGGGTGATT No data
Right 1123667271 15:22617525-22617547 GGACTGGGCTGCTTTCTGAAGGG No data
1123667260_1123667275 17 Left 1123667260 15:22617491-22617513 CCCAAAGTCACCCTGGGGTGATT No data
Right 1123667275 15:22617531-22617553 GGCTGCTTTCTGAAGGGGTGGGG No data
1123667260_1123667267 -10 Left 1123667260 15:22617491-22617513 CCCAAAGTCACCCTGGGGTGATT No data
Right 1123667267 15:22617504-22617526 TGGGGTGATTGGCGAGGGCAAGG No data
1123667260_1123667272 12 Left 1123667260 15:22617491-22617513 CCCAAAGTCACCCTGGGGTGATT No data
Right 1123667272 15:22617526-22617548 GACTGGGCTGCTTTCTGAAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1123667260 Original CRISPR AATCACCCCAGGGTGACTTT GGG (reversed) Intergenic
No off target data available for this crispr