ID: 1123667265

View in Genome Browser
Species Human (GRCh38)
Location 15:22617501-22617523
Sequence TGCCCTCGCCAATCACCCCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1123667265_1123667277 30 Left 1123667265 15:22617501-22617523 CCCTGGGGTGATTGGCGAGGGCA No data
Right 1123667277 15:22617554-22617576 CTGACTGACAAAACTTTGATGGG No data
1123667265_1123667274 6 Left 1123667265 15:22617501-22617523 CCCTGGGGTGATTGGCGAGGGCA No data
Right 1123667274 15:22617530-22617552 GGGCTGCTTTCTGAAGGGGTGGG No data
1123667265_1123667270 0 Left 1123667265 15:22617501-22617523 CCCTGGGGTGATTGGCGAGGGCA No data
Right 1123667270 15:22617524-22617546 AGGACTGGGCTGCTTTCTGAAGG No data
1123667265_1123667276 29 Left 1123667265 15:22617501-22617523 CCCTGGGGTGATTGGCGAGGGCA No data
Right 1123667276 15:22617553-22617575 GCTGACTGACAAAACTTTGATGG No data
1123667265_1123667273 5 Left 1123667265 15:22617501-22617523 CCCTGGGGTGATTGGCGAGGGCA No data
Right 1123667273 15:22617529-22617551 TGGGCTGCTTTCTGAAGGGGTGG No data
1123667265_1123667275 7 Left 1123667265 15:22617501-22617523 CCCTGGGGTGATTGGCGAGGGCA No data
Right 1123667275 15:22617531-22617553 GGCTGCTTTCTGAAGGGGTGGGG No data
1123667265_1123667272 2 Left 1123667265 15:22617501-22617523 CCCTGGGGTGATTGGCGAGGGCA No data
Right 1123667272 15:22617526-22617548 GACTGGGCTGCTTTCTGAAGGGG No data
1123667265_1123667271 1 Left 1123667265 15:22617501-22617523 CCCTGGGGTGATTGGCGAGGGCA No data
Right 1123667271 15:22617525-22617547 GGACTGGGCTGCTTTCTGAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1123667265 Original CRISPR TGCCCTCGCCAATCACCCCA GGG (reversed) Intergenic
No off target data available for this crispr