ID: 1123667270

View in Genome Browser
Species Human (GRCh38)
Location 15:22617524-22617546
Sequence AGGACTGGGCTGCTTTCTGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1123667266_1123667270 -1 Left 1123667266 15:22617502-22617524 CCTGGGGTGATTGGCGAGGGCAA No data
Right 1123667270 15:22617524-22617546 AGGACTGGGCTGCTTTCTGAAGG No data
1123667258_1123667270 14 Left 1123667258 15:22617487-22617509 CCCACCCAAAGTCACCCTGGGGT No data
Right 1123667270 15:22617524-22617546 AGGACTGGGCTGCTTTCTGAAGG No data
1123667260_1123667270 10 Left 1123667260 15:22617491-22617513 CCCAAAGTCACCCTGGGGTGATT No data
Right 1123667270 15:22617524-22617546 AGGACTGGGCTGCTTTCTGAAGG No data
1123667253_1123667270 25 Left 1123667253 15:22617476-22617498 CCCAGGAGTCACCCACCCAAAGT No data
Right 1123667270 15:22617524-22617546 AGGACTGGGCTGCTTTCTGAAGG No data
1123667265_1123667270 0 Left 1123667265 15:22617501-22617523 CCCTGGGGTGATTGGCGAGGGCA No data
Right 1123667270 15:22617524-22617546 AGGACTGGGCTGCTTTCTGAAGG No data
1123667261_1123667270 9 Left 1123667261 15:22617492-22617514 CCAAAGTCACCCTGGGGTGATTG No data
Right 1123667270 15:22617524-22617546 AGGACTGGGCTGCTTTCTGAAGG No data
1123667254_1123667270 24 Left 1123667254 15:22617477-22617499 CCAGGAGTCACCCACCCAAAGTC 0: 7
1: 10
2: 35
3: 54
4: 178
Right 1123667270 15:22617524-22617546 AGGACTGGGCTGCTTTCTGAAGG No data
1123667259_1123667270 13 Left 1123667259 15:22617488-22617510 CCACCCAAAGTCACCCTGGGGTG No data
Right 1123667270 15:22617524-22617546 AGGACTGGGCTGCTTTCTGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1123667270 Original CRISPR AGGACTGGGCTGCTTTCTGA AGG Intergenic
No off target data available for this crispr