ID: 1123667275

View in Genome Browser
Species Human (GRCh38)
Location 15:22617531-22617553
Sequence GGCTGCTTTCTGAAGGGGTG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1123667258_1123667275 21 Left 1123667258 15:22617487-22617509 CCCACCCAAAGTCACCCTGGGGT No data
Right 1123667275 15:22617531-22617553 GGCTGCTTTCTGAAGGGGTGGGG No data
1123667266_1123667275 6 Left 1123667266 15:22617502-22617524 CCTGGGGTGATTGGCGAGGGCAA No data
Right 1123667275 15:22617531-22617553 GGCTGCTTTCTGAAGGGGTGGGG No data
1123667259_1123667275 20 Left 1123667259 15:22617488-22617510 CCACCCAAAGTCACCCTGGGGTG No data
Right 1123667275 15:22617531-22617553 GGCTGCTTTCTGAAGGGGTGGGG No data
1123667261_1123667275 16 Left 1123667261 15:22617492-22617514 CCAAAGTCACCCTGGGGTGATTG No data
Right 1123667275 15:22617531-22617553 GGCTGCTTTCTGAAGGGGTGGGG No data
1123667260_1123667275 17 Left 1123667260 15:22617491-22617513 CCCAAAGTCACCCTGGGGTGATT No data
Right 1123667275 15:22617531-22617553 GGCTGCTTTCTGAAGGGGTGGGG No data
1123667265_1123667275 7 Left 1123667265 15:22617501-22617523 CCCTGGGGTGATTGGCGAGGGCA No data
Right 1123667275 15:22617531-22617553 GGCTGCTTTCTGAAGGGGTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1123667275 Original CRISPR GGCTGCTTTCTGAAGGGGTG GGG Intergenic
No off target data available for this crispr