ID: 1123667277

View in Genome Browser
Species Human (GRCh38)
Location 15:22617554-22617576
Sequence CTGACTGACAAAACTTTGAT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1123667265_1123667277 30 Left 1123667265 15:22617501-22617523 CCCTGGGGTGATTGGCGAGGGCA No data
Right 1123667277 15:22617554-22617576 CTGACTGACAAAACTTTGATGGG No data
1123667266_1123667277 29 Left 1123667266 15:22617502-22617524 CCTGGGGTGATTGGCGAGGGCAA No data
Right 1123667277 15:22617554-22617576 CTGACTGACAAAACTTTGATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1123667277 Original CRISPR CTGACTGACAAAACTTTGAT GGG Intergenic
No off target data available for this crispr