ID: 1123667278

View in Genome Browser
Species Human (GRCh38)
Location 15:22617555-22617577
Sequence TGACTGACAAAACTTTGATG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1123667266_1123667278 30 Left 1123667266 15:22617502-22617524 CCTGGGGTGATTGGCGAGGGCAA No data
Right 1123667278 15:22617555-22617577 TGACTGACAAAACTTTGATGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1123667278 Original CRISPR TGACTGACAAAACTTTGATG GGG Intergenic
No off target data available for this crispr