ID: 1123675489

View in Genome Browser
Species Human (GRCh38)
Location 15:22707241-22707263
Sequence ATTTGTGTATGTTCACTTAA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1123675487_1123675489 -3 Left 1123675487 15:22707221-22707243 CCAATCTGTAGATTCATTTCATT No data
Right 1123675489 15:22707241-22707263 ATTTGTGTATGTTCACTTAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1123675489 Original CRISPR ATTTGTGTATGTTCACTTAA GGG Intergenic
No off target data available for this crispr