ID: 1123681323

View in Genome Browser
Species Human (GRCh38)
Location 15:22766142-22766164
Sequence GAGTCGTATTTCTGAAAGCT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1123681317_1123681323 -3 Left 1123681317 15:22766122-22766144 CCACCAGTCCCCACTCCTGGGAG No data
Right 1123681323 15:22766142-22766164 GAGTCGTATTTCTGAAAGCTTGG No data
1123681314_1123681323 19 Left 1123681314 15:22766100-22766122 CCAGGAGGAGGAGGGGATGCAGC No data
Right 1123681323 15:22766142-22766164 GAGTCGTATTTCTGAAAGCTTGG No data
1123681318_1123681323 -6 Left 1123681318 15:22766125-22766147 CCAGTCCCCACTCCTGGGAGTCG No data
Right 1123681323 15:22766142-22766164 GAGTCGTATTTCTGAAAGCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1123681323 Original CRISPR GAGTCGTATTTCTGAAAGCT TGG Intergenic
No off target data available for this crispr