ID: 1123684544

View in Genome Browser
Species Human (GRCh38)
Location 15:22787365-22787387
Sequence TGCAAAAGGAAGACCCGGGC GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 153
Summary {0: 1, 1: 0, 2: 1, 3: 7, 4: 144}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1123684533_1123684544 3 Left 1123684533 15:22787339-22787361 CCAGTCCCCCGCAGGGGCCTCGC 0: 1
1: 0
2: 1
3: 21
4: 226
Right 1123684544 15:22787365-22787387 TGCAAAAGGAAGACCCGGGCGGG 0: 1
1: 0
2: 1
3: 7
4: 144
1123684537_1123684544 -4 Left 1123684537 15:22787346-22787368 CCCGCAGGGGCCTCGCTGGTGCA 0: 1
1: 0
2: 4
3: 14
4: 184
Right 1123684544 15:22787365-22787387 TGCAAAAGGAAGACCCGGGCGGG 0: 1
1: 0
2: 1
3: 7
4: 144
1123684538_1123684544 -5 Left 1123684538 15:22787347-22787369 CCGCAGGGGCCTCGCTGGTGCAA 0: 1
1: 0
2: 2
3: 11
4: 118
Right 1123684544 15:22787365-22787387 TGCAAAAGGAAGACCCGGGCGGG 0: 1
1: 0
2: 1
3: 7
4: 144
1123684536_1123684544 -3 Left 1123684536 15:22787345-22787367 CCCCGCAGGGGCCTCGCTGGTGC 0: 1
1: 0
2: 2
3: 16
4: 131
Right 1123684544 15:22787365-22787387 TGCAAAAGGAAGACCCGGGCGGG 0: 1
1: 0
2: 1
3: 7
4: 144
1123684535_1123684544 -2 Left 1123684535 15:22787344-22787366 CCCCCGCAGGGGCCTCGCTGGTG 0: 1
1: 0
2: 0
3: 16
4: 142
Right 1123684544 15:22787365-22787387 TGCAAAAGGAAGACCCGGGCGGG 0: 1
1: 0
2: 1
3: 7
4: 144
1123684529_1123684544 13 Left 1123684529 15:22787329-22787351 CCTGGGATTTCCAGTCCCCCGCA 0: 1
1: 0
2: 1
3: 4
4: 91
Right 1123684544 15:22787365-22787387 TGCAAAAGGAAGACCCGGGCGGG 0: 1
1: 0
2: 1
3: 7
4: 144

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1123684544 Original CRISPR TGCAAAAGGAAGACCCGGGC GGG Intronic
901082678 1:6592540-6592562 TTCTAAAGGAAGTCCTGGGCAGG - Exonic
902241339 1:15091637-15091659 TGAAAAAGGAAAACACGGCCGGG - Intronic
903127405 1:21257379-21257401 TGAAACAGGCAGACCCTGGCAGG - Intronic
903343764 1:22671523-22671545 TCCAAAAGGAAGAGCCCGGCCGG - Intergenic
904978215 1:34474699-34474721 GGCAAAAGGTAGACTTGGGCGGG - Intergenic
905923413 1:41733688-41733710 TGCAAAAGAAAGTGCCAGGCAGG + Intronic
906261334 1:44393487-44393509 TGAAAAAGGAAGATCAGGCCGGG - Intergenic
907333790 1:53687677-53687699 TGCTATGGGAAGACCCTGGCTGG - Intronic
909369336 1:74865691-74865713 TAAAAAAGCAAGACCCGGCCAGG - Intergenic
912484549 1:110015123-110015145 TGCAAAAGGAGAACTGGGGCAGG - Intronic
916349473 1:163832856-163832878 TGCAAGATTAAGACCCTGGCAGG + Intergenic
917630701 1:176888631-176888653 TGCAAAGGGAATACTGGGGCAGG - Intronic
918007949 1:180559610-180559632 TGGAAAAGAAAAACCCGGCCGGG + Intergenic
918682693 1:187374660-187374682 TGAAAAAGAAAGATCCAGGCTGG - Intergenic
919276540 1:195424716-195424738 TGAAAAGGGAAGAACTGGGCCGG + Intergenic
919731303 1:200915297-200915319 TGCCAAGGGAAGACCCAGGATGG + Intronic
920415753 1:205798348-205798370 TGCAAAATGAAGAAGCGGGTGGG - Intronic
1066192458 10:33068602-33068624 TGCAACAGGAAGAACAGGACTGG - Intergenic
1069379576 10:67829128-67829150 AGCAAAAAGCAGACTCGGGCGGG + Intronic
1075031724 10:119029027-119029049 TGCAAACGGAAGCCACTGGCTGG + Intergenic
1076398896 10:130164433-130164455 TTCAAAAGTAAGAGCCCGGCTGG - Intronic
1076480847 10:130784425-130784447 CACAAAAGGAAGACGGGGGCAGG + Intergenic
1077390759 11:2299776-2299798 GGAAAAAGGAAGTCCCTGGCGGG + Intronic
1078592458 11:12655736-12655758 TGAAAATGTAAGACACGGGCAGG + Intergenic
1080895356 11:36444721-36444743 AGAAAAAGGAAGACTGGGGCAGG - Intronic
1081243781 11:40738303-40738325 TGCAAACTGAAGACCCTGGGAGG - Intronic
1082988086 11:59185023-59185045 GGAAAAAGGAAGACCAGGGAGGG + Intronic
1083858604 11:65406641-65406663 TTAAAAAGGAATACCCTGGCCGG + Intronic
1087643221 11:100777884-100777906 TACAAAAGGTAGAACTGGGCGGG + Intronic
1088909148 11:114177546-114177568 CTCAAAATGAAGTCCCGGGCCGG - Intronic
1089080853 11:115775244-115775266 TGCAAAAGGAAGACCCCATCAGG - Intergenic
1089415800 11:118289335-118289357 AGAAAAAGGAAGAGCAGGGCAGG + Intergenic
1089698544 11:120230509-120230531 TGTAATAGGAAGTGCCGGGCAGG + Intergenic
1090644064 11:128753208-128753230 TGTAAAAGGAACCCCTGGGCTGG - Intronic
1090985512 11:131762514-131762536 TGGAAAATGACGACCCGAGCTGG + Intronic
1093900499 12:24625803-24625825 GGCATAGGGAAGACCCTGGCTGG + Intergenic
1094162092 12:27402101-27402123 TGCTAAAGCAACACCTGGGCTGG - Intronic
1097463932 12:59899190-59899212 GGAAAAAGGAAGACCCTGCCAGG - Intergenic
1104278632 12:127353504-127353526 TGCACATGAAAGACCCGTGCAGG - Intergenic
1104761186 12:131298558-131298580 TGGGAAGGGAAGAACCGGGCAGG + Intergenic
1104775345 12:131387428-131387450 GGTAACAGGAAGACACGGGCGGG - Intergenic
1104818589 12:131662234-131662256 TGGGAAGGGAAGAACCGGGCAGG - Intergenic
1106466659 13:30019898-30019920 TGCAGAAGGAAACCCAGGGCAGG + Intergenic
1116998191 14:51346326-51346348 TAGAAAAGAAAGACCCAGGCTGG + Intergenic
1118179269 14:63474941-63474963 GGCAAAAGGAAAACCTGAGCAGG + Intronic
1118736031 14:68702593-68702615 TGCAGAAGGAAGGCCAGGGGAGG + Intronic
1119821740 14:77622138-77622160 TGAAAAGGGAAGACCAGGCCAGG - Intergenic
1122660888 14:103293994-103294016 TGGAGAGGGAAGACCCGGGGTGG - Intergenic
1123684544 15:22787365-22787387 TGCAAAAGGAAGACCCGGGCGGG + Intronic
1124790401 15:32720589-32720611 TGCAGATCGAAGACACGGGCTGG - Intronic
1125610329 15:40965083-40965105 TGCAAAATGAAGAGCTGGACCGG + Intergenic
1127923889 15:63519058-63519080 TTGAAAAGAAAGACCCGGCCAGG - Intronic
1127967214 15:63931381-63931403 TGAAAAAGGAAGAGAAGGGCAGG + Intronic
1129334132 15:74842520-74842542 TGCAGTAGGTAGACCCGGGGAGG - Intronic
1129620566 15:77140752-77140774 TGACAAAGGAAGACCCTGTCTGG - Intronic
1130095761 15:80854747-80854769 TGCAAAGGGAAGTCCTGGGGAGG + Intronic
1130095895 15:80855817-80855839 AGCAAAAAGAAGGCACGGGCTGG - Intronic
1131162140 15:90113278-90113300 TGCAAAAGGAAGGCCGGGGCGGG - Intergenic
1131176447 15:90212261-90212283 TCAAAAAGGCAGACCGGGGCTGG - Intronic
1131407207 15:92175268-92175290 TGCAGAGTGAAGACCCGTGCTGG + Intergenic
1134306820 16:13040473-13040495 TGCAAAAGAAAGAGACTGGCAGG - Intronic
1135771365 16:25220752-25220774 TCATAAAGGGAGACCCGGGCCGG + Intronic
1135881254 16:26259822-26259844 AGCACAAGGAAGAACGGGGCTGG - Intergenic
1137244237 16:46689537-46689559 CGCAAAAGGAAGACCCTGATTGG + Intergenic
1141311348 16:82916277-82916299 AATAAAAGGAAGACCCTGGCCGG + Intronic
1142191247 16:88719143-88719165 TTCAAAAAGAAACCCCGGGCCGG - Intronic
1142605417 17:1078592-1078614 TGCAAATGGAAGGACCAGGCTGG - Intronic
1144845765 17:18218041-18218063 TGCCAAAGGAGGCCCCGGTCTGG - Intergenic
1147244252 17:39109844-39109866 TGGAAAAGGAAAATCTGGGCTGG + Intronic
1150306493 17:64089675-64089697 TGCAACAGATAGACCCGAGCCGG + Intronic
1150951610 17:69808535-69808557 TAGAAAAGGAAAGCCCGGGCCGG - Intergenic
1151426452 17:74033864-74033886 TGCCAAAGACAGACCCGGGAAGG - Intergenic
1152286009 17:79413767-79413789 CGCAGAAGGATGGCCCGGGCTGG - Intronic
1153836532 18:8969177-8969199 TGCTGAAGGAAGCCCCCGGCAGG + Intergenic
1157686397 18:49646042-49646064 TGCAATAGGAAGAGCGGGGGAGG + Intergenic
1157693079 18:49699473-49699495 AGCAATAGGAAGACCCGGAAAGG - Intergenic
1158933000 18:62339268-62339290 AGCAAATGGGAGACTCGGGCAGG - Intronic
1160511830 18:79457251-79457273 GGCATGAGGAAGACACGGGCAGG - Intronic
1166106288 19:40599661-40599683 AGCAAAAGAAAGAGCCGGGGAGG - Intronic
925780305 2:7375859-7375881 AGCAAAAGGGAGACCAAGGCTGG + Intergenic
925838236 2:7966183-7966205 TGTAAAAGGCAGAGCCAGGCTGG - Intergenic
926993612 2:18708543-18708565 TCCAAAAGGAATACCCAGGGAGG + Intergenic
928199351 2:29237461-29237483 TGCTCAAGGAACACTCGGGCTGG - Intronic
929541736 2:42828199-42828221 CGCCAAATGAAGACCTGGGCTGG + Intergenic
929807503 2:45159848-45159870 TGCAACAGGAGGACAGGGGCTGG + Intergenic
930556266 2:52899260-52899282 TGCCCAAGCAAGACCCGGGCAGG + Intergenic
930917491 2:56711458-56711480 TGAAAAAAGAAAACCTGGGCAGG - Intergenic
931308732 2:61057987-61058009 TGAACAAGGAAGATCCTGGCTGG - Intergenic
931753572 2:65351612-65351634 AGCACAAGGAAGACCGGGGGCGG - Intronic
938548146 2:132353339-132353361 TGGCAGAGGAGGACCCGGGCGGG + Intergenic
939285682 2:140126035-140126057 TGCAAAAGGTAGACTCTGACTGG + Intergenic
941204795 2:162558468-162558490 TGCAAAAGAAAGAGCCTGGCCGG - Intronic
942385214 2:175435480-175435502 TGCAAAGGGAAGATCCAGGGAGG - Intergenic
948939893 2:241190440-241190462 GGCAAAGGCAAGACCAGGGCGGG + Intronic
1171390558 20:24799078-24799100 CGCAAAAGGCAGGCCCTGGCTGG + Intergenic
1171877017 20:30586111-30586133 TGGCAGAGGAGGACCCGGGCGGG + Intergenic
1171978875 20:31612943-31612965 GGCCAAAGGAAGACGGGGGCGGG - Intergenic
1173594039 20:44247507-44247529 CGCAGAAGGTAGAGCCGGGCCGG + Exonic
1174116648 20:48230936-48230958 TCCTAAAGGAAGACCTGGGGAGG - Intergenic
1178863613 21:36309610-36309632 TGAAAAAGGGAGACCCGGCCGGG - Intergenic
1180978774 22:19868866-19868888 TGCAGAAGAAAGTCCCAGGCAGG + Intergenic
1181749850 22:24981612-24981634 TTCAAAAGGAAAACTCGGCCAGG + Intronic
1182066409 22:27434586-27434608 TGGAAAAGGAAGTCCAGGGTGGG - Intergenic
1183046887 22:35227553-35227575 TGCAAAAGGAAGTCTGGGGCAGG - Intergenic
1183393261 22:37557852-37557874 TGCAAAAGGGACACCATGGCAGG + Intergenic
1184088939 22:42282525-42282547 TGCAGAACGAAGGCCAGGGCTGG - Intronic
1184128997 22:42506080-42506102 TTCAAAAGGAAAACAAGGGCCGG + Intergenic
1184160996 22:42697372-42697394 TGCAGAAGAAAGACAGGGGCAGG - Intronic
1184609110 22:45591100-45591122 TGCCAAAGGAAGACAAGGTCTGG - Intronic
1185298402 22:50065851-50065873 TTCAAAAGGAAGATGCGTGCAGG + Intronic
1185371038 22:50461103-50461125 TGCAGGAGAAAGACCAGGGCGGG + Intronic
954199235 3:49014375-49014397 TGCAAAAGAAAGAGCCTGGGGGG - Exonic
954447730 3:50555609-50555631 TGCAAGTGGAAGATCAGGGCAGG - Intergenic
959951310 3:112183787-112183809 TGCCAAGGGAAGACCCAGGATGG - Intronic
962025666 3:131544755-131544777 TGCACCTGGAAGACCAGGGCAGG + Intronic
962338852 3:134563877-134563899 TGCAAATGAAAGACCCGAACAGG - Exonic
962426234 3:135271464-135271486 TGCAAAAGGAAGAGGGGGGGTGG - Intergenic
962846474 3:139278539-139278561 GGCAAAAGGCAGAGCCAGGCAGG - Intronic
967056552 3:185834127-185834149 TGCAAAAGAAAATCCCAGGCTGG + Intergenic
968182566 3:196607183-196607205 TTCAAAATGAAGACTGGGGCTGG - Intergenic
968481570 4:835275-835297 TGCAGCAGGATGACCCGAGCCGG - Intergenic
978943400 4:114464799-114464821 TAGAAAAGAAAGACACGGGCAGG - Intergenic
979245420 4:118498473-118498495 GGCAAAAGGAAGACCTTGTCAGG + Intergenic
979437142 4:120706565-120706587 TTCAAAAGAGAGACCTGGGCAGG + Intronic
989673717 5:43949925-43949947 TTTAAAAGGAGGACCCGGGCCGG + Intergenic
997360242 5:133290444-133290466 TGAAGAGGGAAGACCCAGGCTGG - Intronic
997735382 5:136209123-136209145 TGCAGAAGGCAGACCCAGCCAGG + Intergenic
999176914 5:149638319-149638341 TGCACAAGGACAAGCCGGGCAGG + Intergenic
1004160480 6:13208537-13208559 TGGAGAGGGAAGACCCAGGCTGG - Intronic
1005942267 6:30569381-30569403 TTTAAAAGGATGACCTGGGCTGG - Intergenic
1006133171 6:31880742-31880764 TGCAGCATGAAGACCCGGACGGG + Exonic
1008609896 6:53176099-53176121 TGCAAAAGGCTAACCAGGGCCGG - Intergenic
1011781439 6:90794343-90794365 TGGAAAAGGAAGGCCAGGCCTGG - Intergenic
1016345143 6:143105279-143105301 AGCAAAAGGAAGACCCTGCATGG + Intronic
1020476177 7:8597688-8597710 TGTAAAAGGAGGATCCGGGTGGG + Intronic
1020518316 7:9154006-9154028 TTAAGAAGGAAGACCCGTGCAGG - Intergenic
1027164610 7:75825505-75825527 GGCAAAAGGAAGAGGTGGGCCGG + Intergenic
1029906104 7:104094900-104094922 TGGAATAGGAATACCCTGGCCGG + Intergenic
1034359842 7:150485226-150485248 GGAAAAAGGAAGCCCCAGGCAGG - Intergenic
1038843329 8:31206114-31206136 TGCAAAAGAGAGAACGGGGCTGG - Intergenic
1041610554 8:59842371-59842393 TGGAAAAGAAAGCCACGGGCTGG - Intergenic
1045644144 8:104283829-104283851 TGGAAATGGAAGACCCACGCAGG + Intergenic
1053286378 9:36851972-36851994 TGGAAGAGGAAGAGCCGGCCTGG - Intronic
1054833595 9:69652692-69652714 TTCAAAAACAAGACCCTGGCTGG + Intronic
1055569710 9:77604148-77604170 TGAAAGAGGAACACCTGGGCAGG - Intronic
1059655919 9:116357502-116357524 TGCAGAAAGAAGGCCCGGGGAGG + Intronic
1062532407 9:137007712-137007734 TGCCAAAGGCTGACCCGGCCCGG - Exonic
1062707592 9:137953969-137953991 TGCAGAAGGAAGCCCTGAGCAGG - Intronic
1188567446 X:31543110-31543132 TGCAGATGGAAGACCCTTGCTGG + Intronic
1188865817 X:35312042-35312064 GGAAAAAGGAAGGCTCGGGCGGG - Intergenic
1196052893 X:111324160-111324182 TCCAGAAGGAAGATCGGGGCTGG + Intronic
1198696259 X:139342042-139342064 AGCACATGGAAGACCCGCGCCGG + Intergenic
1198770522 X:140125828-140125850 TGGAAAAGGAAGAGAAGGGCAGG - Intergenic