ID: 1123685616

View in Genome Browser
Species Human (GRCh38)
Location 15:22795022-22795044
Sequence AGGGAGCCGCAGAGTGAGGA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 547
Summary {0: 1, 1: 0, 2: 1, 3: 50, 4: 495}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1123685608_1123685616 27 Left 1123685608 15:22794972-22794994 CCACTGGGAGGAATGGGCTGGAC 0: 1
1: 0
2: 1
3: 26
4: 308
Right 1123685616 15:22795022-22795044 AGGGAGCCGCAGAGTGAGGATGG 0: 1
1: 0
2: 1
3: 50
4: 495

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1123685616 Original CRISPR AGGGAGCCGCAGAGTGAGGA TGG Intronic
900932829 1:5747619-5747641 AGGGAGGAGCAGAGGGAGGGAGG + Intergenic
900932844 1:5747664-5747686 AGGGAGGAGGAGAGGGAGGAAGG + Intergenic
901266386 1:7914059-7914081 AGGAAGCCACAGGGTGAGCAGGG - Intergenic
901386124 1:8910467-8910489 ATGGAGCTGGAGAATGAGGAAGG + Intergenic
901458382 1:9376883-9376905 AGGCCTCCCCAGAGTGAGGAGGG - Intergenic
902768867 1:18634252-18634274 AGAGAGGTGCAGGGTGAGGATGG - Intronic
903024699 1:20419013-20419035 GGGGGGCCCCAGAGTGAGGAAGG + Intergenic
903117830 1:21192678-21192700 TGGCAGCAGGAGAGTGAGGAAGG - Intergenic
903384884 1:22919695-22919717 AGGGAGCAGGAGAGGGAGGAGGG + Intergenic
904894107 1:33801192-33801214 AGAGAGATGGAGAGTGAGGATGG - Intronic
905011095 1:34747633-34747655 AGGGGCCCGCTGGGTGAGGAGGG + Intronic
905304262 1:37006706-37006728 CGGGCGCCGCAGAGTGAGGGAGG + Intronic
906292378 1:44627701-44627723 AGGGAGGCCCAGTGTGAGAAGGG + Intronic
906771488 1:48489136-48489158 AGGGAGAGGGAGAGAGAGGAAGG - Intergenic
906789516 1:48646267-48646289 AAGGAGGCTCAGAGTGATGACGG + Intronic
907451196 1:54547025-54547047 AGGGAGGCCCAGAGAAAGGAGGG + Intronic
907534740 1:55140720-55140742 GGGCAGCAGCAGAGTGAGGTAGG + Intronic
907937645 1:59057199-59057221 TGGGAGGTGCAGAGTGAAGAGGG + Intergenic
909252924 1:73381311-73381333 AGGGAGCAGGAGAGTGAGGTGGG - Intergenic
909292754 1:73904548-73904570 AGGGAGCAGGAGAGGAAGGAGGG + Intergenic
909591439 1:77353610-77353632 AGTGAGACGCAGAGTGGGTAAGG - Intronic
911182664 1:94875154-94875176 AGGGAGCAGCAGAGTGTAGGCGG - Intronic
911647697 1:100353188-100353210 AGGGAGCTGCAGAGGGAGCAAGG - Intronic
912671426 1:111630991-111631013 AGGGATCTGCAGAGATAGGAAGG + Intronic
915646090 1:157273715-157273737 AAGGAGTTGCAGAGTGGGGATGG + Intergenic
915661284 1:157407743-157407765 AGGGAGCAAGAGAGAGAGGAGGG + Intergenic
916128821 1:161593587-161593609 AGGGAGCAGCGGTGGGAGGATGG + Intronic
916138737 1:161675418-161675440 AGGGAGCAGCAGTGGGAGGATGG + Intronic
916300823 1:163272017-163272039 AGGGAGACAGAGAGAGAGGAAGG - Intronic
918385744 1:184005635-184005657 ACGGAGAGGCAGAGTGTGGATGG - Intronic
920022445 1:202966532-202966554 AGGCAGCCCCAGAGTGTGGTGGG + Exonic
920051678 1:203168148-203168170 AGAGAGGTGCAGAGTGGGGAGGG + Intronic
920708805 1:208275598-208275620 AGAGGGCCGCGGAGGGAGGAGGG - Intergenic
920792373 1:209105613-209105635 AGGAAGCCCCAGTGTGTGGAGGG - Intergenic
920910031 1:210207674-210207696 AGGGAGGGACAGAGGGAGGAAGG + Intergenic
921297993 1:213722640-213722662 AGGGAGACCCAGAGTGAACAAGG + Intergenic
921686347 1:218093347-218093369 TGGAAACCGCAGAGTGAGTAAGG - Intergenic
921732399 1:218593069-218593091 AGGGAGCAAGAGAGAGAGGATGG + Intergenic
921776947 1:219112188-219112210 AGGAAGCTGCAGTGTGGGGAAGG - Intergenic
921861401 1:220046101-220046123 AGGGAGGCGCAGTGTGAGCCCGG - Intronic
921976926 1:221213135-221213157 AGAGAGCCACAGGGTGGGGAGGG - Intergenic
922784450 1:228276149-228276171 AGGGAGCGGAAAAGAGAGGAGGG + Intronic
922791157 1:228311833-228311855 AGGGAGGAGGAGAGTGTGGAAGG + Intronic
922891413 1:229064772-229064794 AGAGAGCCCAGGAGTGAGGAGGG + Intergenic
924260787 1:242228663-242228685 AGGGAGAGGGAGAGAGAGGAAGG + Intronic
924888618 1:248248473-248248495 AGGGAGTGACAGAGGGAGGAAGG + Intergenic
1063740530 10:8813993-8814015 AGGGAGCGGCATAGGGAGGGTGG + Intergenic
1064724940 10:18269747-18269769 AGGGAGGAGCAGAGAGAGGGAGG - Intronic
1065876911 10:30005171-30005193 AGGGAGGGGGGGAGTGAGGATGG - Intergenic
1066148401 10:32587395-32587417 AGAGAGCAACAGAGAGAGGAAGG + Intronic
1066200954 10:33142330-33142352 AGGGAGCTGCTGATGGAGGAGGG + Intergenic
1067222157 10:44352221-44352243 AGGGAGACAAAGAGTGAGGAGGG - Intergenic
1067790098 10:49281468-49281490 AGGGAGCCGAAGAGGGAGCCAGG - Intergenic
1068369755 10:56096726-56096748 AGGCAGCAACAGAGTGAGGGAGG + Intergenic
1068833949 10:61531364-61531386 AGGGAGTAGGAGAGTGGGGATGG + Intergenic
1068878162 10:62019859-62019881 AGGGAGCCACAGAATTAGCAAGG + Intronic
1069720117 10:70544494-70544516 AGGCAGGAGCTGAGTGAGGAGGG + Intronic
1070276064 10:75008147-75008169 ATGGTGATGCAGAGTGAGGATGG + Intronic
1070282461 10:75059662-75059684 TGGGAGGTGCAGTGTGAGGAGGG + Intergenic
1070313072 10:75287702-75287724 ATGGAGCAGCAGAATGAGGAGGG - Intergenic
1070696983 10:78570823-78570845 AGGGCCAGGCAGAGTGAGGATGG - Intergenic
1070732596 10:78841724-78841746 AGGGACCCCGAGAGTGAGCATGG + Intergenic
1071497555 10:86179296-86179318 AGGGAGGGGAAGAGGGAGGAGGG - Intronic
1072289639 10:93952293-93952315 AAGGACCTGGAGAGTGAGGAGGG + Intronic
1072317356 10:94215676-94215698 AGCCAGCAGCAGAGAGAGGATGG + Intronic
1073418503 10:103404729-103404751 AGTGAGCCGAAGAATGAGTAAGG + Intronic
1074112304 10:110431185-110431207 AGGGAGCCGCACCCTGAGGAAGG + Intergenic
1074863473 10:117531267-117531289 AGGAAGCCACTGGGTGAGGAAGG - Intergenic
1075345591 10:121679740-121679762 AGGGAGAGGCAGACTGAGGAGGG - Intergenic
1075530336 10:123223673-123223695 AGGGTGCAGCTGAGAGAGGAAGG - Intergenic
1075885617 10:125896643-125896665 ATGGAGCCCCAGAGTAAGGGAGG + Exonic
1076525953 10:131112501-131112523 AGAGGGCCGCAGAGTGGGGCAGG - Intronic
1076547195 10:131253313-131253335 AGTGAGGGGCAGAGTGAGGGCGG - Intronic
1076922199 10:133459876-133459898 AGGGAGCCTCAGGGTGCGGCTGG + Intergenic
1077309175 11:1880900-1880922 AGGGAGCCCCAGACTGATGGGGG + Intronic
1077309227 11:1881104-1881126 AGGGAGCCCCAAACTGATGAGGG + Intronic
1077657060 11:4029538-4029560 AGGGAGAGGGAGAGAGAGGAGGG + Intronic
1077782591 11:5347791-5347813 AGGGAGCAGAAGAGGGAGGGAGG + Intronic
1078076531 11:8166928-8166950 AGGGAGGGACAGAGGGAGGAAGG + Intronic
1079465911 11:20730735-20730757 TGAGAGCAGCAGACTGAGGATGG + Intronic
1080394313 11:31875902-31875924 AGGAAGCTGCAGAAGGAGGAGGG - Intronic
1081629996 11:44682563-44682585 AGGGATGTGCAGAGTGAGGGAGG - Intergenic
1081744803 11:45465323-45465345 AGGGAGTCTCAGAGGGAGGGAGG - Intergenic
1081751048 11:45511616-45511638 AGGGAGCAGATGAGAGAGGAGGG - Intergenic
1083737374 11:64689207-64689229 AGGGAGACACAGAGAGAGGCAGG - Intronic
1084021547 11:66420906-66420928 CGGGAGCCGCTGACTGGGGAGGG - Intergenic
1084229219 11:67738702-67738724 AGGGAGGGGCACAGTGAGCAGGG + Intergenic
1084813101 11:71627637-71627659 AGGGAAGGGCAGAGTGAGCAGGG - Intergenic
1085029378 11:73260359-73260381 AGGGAGCTGGGGAGTCAGGAGGG + Intergenic
1085202099 11:74708062-74708084 AGGGAAAGGCAGAGTGAAGAAGG - Intronic
1087294678 11:96357126-96357148 AGGGACAGACAGAGTGAGGATGG + Intronic
1089517806 11:119044875-119044897 AGGGAGGGGCACAGTGAAGAAGG - Exonic
1089959697 11:122604881-122604903 AGTGAGCAGCAGAGTGAGTAGGG + Intergenic
1091095955 11:132822244-132822266 TGGGAGAGGGAGAGTGAGGAGGG - Intronic
1091568199 12:1662735-1662757 AGGGAGGCGGGAAGTGAGGAGGG - Intergenic
1091705962 12:2693551-2693573 AGGCTGCTCCAGAGTGAGGAAGG - Intronic
1091951448 12:4596355-4596377 AGGGAGAGGCACAGTCAGGAAGG - Intronic
1092364996 12:7870639-7870661 AGTGAGGCGCAGGGTGGGGAAGG - Intronic
1092442514 12:8519379-8519401 AGGGAGGGGTAGAATGAGGAAGG - Intronic
1094232820 12:28127519-28127541 AGTGAGTCAGAGAGTGAGGAGGG - Intergenic
1095685408 12:45027977-45027999 AAGAAGCCGCTGAGTTAGGATGG + Intronic
1096078296 12:48818270-48818292 AGAGAGAGGCAGAGGGAGGACGG - Intronic
1096263195 12:50105452-50105474 TGGGAGCCAAAGAGTGAGGCTGG - Intronic
1096556832 12:52409023-52409045 AGGGAGAGGGAGAGGGAGGAGGG - Intergenic
1096647781 12:53047800-53047822 AGGGGGCCGCAGAGCGGGGCTGG - Intronic
1096863503 12:54547278-54547300 AAGGAGCCACAGAGTGAAAAAGG + Exonic
1097179471 12:57163031-57163053 AGGATGCCGAAGAGTGGGGAGGG + Intronic
1097804650 12:63952139-63952161 AGTGAGGTGCAGAGTGGGGAGGG - Intronic
1099051257 12:77783983-77784005 AGGGAGAAGCAGAGTCATGATGG - Intergenic
1099443854 12:82729001-82729023 AGGAGGCCGCAGGGTGAGGGCGG - Intronic
1099955147 12:89346022-89346044 AGGGAGGCACAGAGAGAGGTGGG + Intergenic
1100725830 12:97407587-97407609 CAGGAGCTGCAGAGTGAGGTTGG - Intergenic
1100959014 12:99942364-99942386 AGAGAGCAGCAGAGTGATAAGGG + Intronic
1101535555 12:105613147-105613169 AGGCAGCAGGAGAGAGAGGAAGG - Intergenic
1102122358 12:110451554-110451576 AGGAAACCTCAGAGAGAGGATGG - Intergenic
1102514143 12:113435288-113435310 AGGGAGAAGCAGAGTGAGGGAGG - Intronic
1102598741 12:114012875-114012897 AGGGAGAGGGAGAGGGAGGAGGG + Intergenic
1102682231 12:114698626-114698648 AGGGAGATGGAGAGAGAGGAGGG - Intergenic
1103241162 12:119414342-119414364 AGGGAGACACACAGTGAGGATGG - Intronic
1103244699 12:119446599-119446621 AGGGAGAGGGAGAGGGAGGACGG + Intronic
1103261695 12:119594105-119594127 AGGGAGCCGCAGAGAGCGCGCGG - Intronic
1103447647 12:121004583-121004605 AGGTGGCCGCAGAGAGAGGCAGG + Intronic
1103524139 12:121556394-121556416 AGGGAGCAAGAGAGAGAGGAGGG - Intronic
1103597865 12:122035108-122035130 AGAGAGCCCCACAGTGGGGAGGG - Intronic
1103899294 12:124295182-124295204 CGGGAGCCGCGGAGGGCGGAGGG + Intronic
1104426584 12:128682975-128682997 AGGCAGACGCACAGGGAGGACGG - Intronic
1104483657 12:129130409-129130431 AGGGAGGGGCAGAGTCAGGATGG - Intronic
1104668851 12:130666976-130666998 AGGGAGGGACAGAGGGAGGAAGG + Intronic
1104938019 12:132376952-132376974 AGGGAGACAGAGAGAGAGGAAGG + Intergenic
1104938032 12:132377024-132377046 AGGGAGACAGAGAGAGAGGAAGG + Intergenic
1105771575 13:23617211-23617233 AGGGAGTGGCAGAGAGAGGGAGG + Intronic
1105883744 13:24624984-24625006 AGGGGGCCTGAGAGTGAGGAAGG + Intergenic
1106775165 13:33001865-33001887 AGGTGGCGGCAGAGTGGGGAAGG - Intergenic
1108289306 13:48942364-48942386 AGGGAGTATCTGAGTGAGGAGGG + Intergenic
1108556836 13:51601720-51601742 AGGAAGAGGCAGAGTGGGGAAGG + Intronic
1108689539 13:52848602-52848624 GGAGAGGCGCAGAGTGAGGGCGG - Exonic
1109306319 13:60645861-60645883 AAGGAGACTCAGAGTGAGGGAGG - Intergenic
1109837987 13:67883756-67883778 AGGGAGCAACAGAGAGAGGAGGG - Intergenic
1111452600 13:88438685-88438707 AGGGAGGGACAGAGGGAGGAAGG + Intergenic
1112443368 13:99441853-99441875 AGAGAGACACAGAGTGAAGACGG + Intergenic
1112870860 13:103969047-103969069 AGGAAGCAGGAGGGTGAGGAGGG + Intergenic
1113505532 13:110813405-110813427 AGGGAGGCGCGACGTGAGGAGGG - Intergenic
1113914538 13:113862919-113862941 CAGGAGCCGCCGTGTGAGGACGG - Intronic
1115306959 14:31943622-31943644 GGGGAGCTGAGGAGTGAGGATGG + Intergenic
1118905129 14:70018134-70018156 AGGGAGCTGCAGGGTTAGGTGGG + Intronic
1118925587 14:70188096-70188118 AGGGTGCCGCCGGGTGGGGAGGG - Intronic
1119046142 14:71320591-71320613 AGGGAGCCACAGAGGCGGGAGGG - Intronic
1119749637 14:77068203-77068225 AGGGTGCCCCAGAGTGGGGCCGG - Intergenic
1122286542 14:100655789-100655811 GGAGAGCACCAGAGTGAGGAGGG - Intergenic
1122299499 14:100723823-100723845 AGGGATGCGCAGATAGAGGAGGG + Intergenic
1122874494 14:104657414-104657436 AGGGAGAGGCAGGGTTAGGAGGG - Intergenic
1202872451 14_GL000225v1_random:177297-177319 ATGGAGCCCCAGAGTAAGGGAGG - Intergenic
1123685616 15:22795022-22795044 AGGGAGCCGCAGAGTGAGGATGG + Intronic
1124099720 15:26682278-26682300 AGGGAGTGGGAGAGGGAGGAAGG - Intronic
1124218239 15:27826947-27826969 AGGAAGCTGCCCAGTGAGGATGG - Intronic
1125612590 15:40981934-40981956 AGGGAGGAGAAGAATGAGGAAGG - Intronic
1126658573 15:51008303-51008325 AGGGAGCAAGAGAGAGAGGAGGG + Intergenic
1128072786 15:64807852-64807874 GGGAAGGTGCAGAGTGAGGATGG - Intergenic
1128618971 15:69132768-69132790 AGGGAGCCAGAGCATGAGGAAGG + Intergenic
1128700346 15:69799422-69799444 AGGGAGACTCAGAGTCAGGGAGG + Intergenic
1129062867 15:72874176-72874198 AGGGCCCAGCAGAGTCAGGAGGG + Intergenic
1129207414 15:74045265-74045287 AGGGAGGTCCTGAGTGAGGAAGG + Exonic
1130099141 15:80878873-80878895 AGGGAGCAGCAGAGAGAGATTGG - Intronic
1130390103 15:83447581-83447603 AGGGAGGCGCAGAGGAGGGAAGG + Intronic
1130856038 15:87840885-87840907 AGGGAGGGGGAGAGGGAGGAGGG + Intergenic
1130864158 15:87917753-87917775 AGGGAGCAAGAGAGAGAGGAAGG - Intronic
1130995778 15:88903216-88903238 GGGGAGGCTGAGAGTGAGGAGGG - Intronic
1131652179 15:94412062-94412084 ATGGAGCCACAGAATGAGGTAGG + Intronic
1132057798 15:98665339-98665361 AGGCAGATGCAGAGTCAGGAGGG - Intronic
1132647674 16:1006675-1006697 AGGTGGCCGCAGAGGGAGCAGGG - Intergenic
1132892449 16:2210919-2210941 GGGGAGGCGCAGGGTCAGGAGGG - Exonic
1133618750 16:7505740-7505762 AGGGAAGCACAGAGAGAGGATGG - Intronic
1134195640 16:12157041-12157063 AGGGAGCCGGAGGGTGAGAAGGG + Intronic
1134338547 16:13324044-13324066 AGGGAGCAAGAGAGAGAGGAAGG - Intergenic
1134425428 16:14138712-14138734 AGCGAGCCGCAAAGTGGGGTGGG - Intronic
1134449355 16:14354095-14354117 GGGGAGGGGCAGAGGGAGGAGGG + Intergenic
1134746884 16:16595377-16595399 AGGGATTTGCAGAGTGAGGCTGG + Intergenic
1134998590 16:18758286-18758308 AGGGATTTGCAGAGTGAGGCTGG - Intergenic
1136577546 16:31133383-31133405 AGGGAGCTGCCCAGGGAGGAAGG + Exonic
1136613184 16:31379689-31379711 TGGGAGCCGGAGACTGGGGAGGG + Intronic
1137378996 16:47980586-47980608 AGAGAGGAGCAGAGTTAGGAAGG - Intergenic
1139029147 16:62858355-62858377 AGGGGGGGGCAGAGAGAGGATGG - Intergenic
1139599511 16:67978154-67978176 AGGGGTCCGCAGAGGGAGGCTGG - Intronic
1139650933 16:68361739-68361761 AGGGTCCTGGAGAGTGAGGAGGG - Exonic
1140410227 16:74736760-74736782 AGGGAGTGGCAGAGGGAGGGAGG - Intronic
1140908388 16:79429522-79429544 AGGAAGCAGCAGAGAGAGGGAGG + Intergenic
1141231374 16:82170485-82170507 AGGGAGTCCCCGAGGGAGGATGG - Intergenic
1141422429 16:83925688-83925710 AGGGAGTCCCAGACTGAGGGAGG - Exonic
1141631637 16:85291277-85291299 AGGGAGGAGGAGGGTGAGGAGGG - Intergenic
1141705399 16:85661798-85661820 GGAGAGCCGCACAGTGGGGATGG + Intronic
1142360727 16:89625317-89625339 AGGGAGGCAGAGAGTGAGGGGGG + Intronic
1142899577 17:3003828-3003850 AGAGAGGCGCACAATGAGGATGG + Intronic
1143363205 17:6388047-6388069 AGGGTGGAGCAGAGTGAGAAGGG + Intergenic
1143408062 17:6691086-6691108 AGGAGACAGCAGAGTGAGGACGG - Intronic
1143457637 17:7078181-7078203 AGGGAGCTGTCTAGTGAGGAGGG + Intronic
1143668144 17:8376606-8376628 AAAGAGCTGCAGACTGAGGAAGG + Intronic
1143757060 17:9074912-9074934 TGGGAAACGCAGAGTGAGGACGG - Intronic
1143971237 17:10797420-10797442 AGGGATTGGGAGAGTGAGGAAGG - Intergenic
1143982262 17:10880153-10880175 AGGGAGTGGCTGAGTTAGGATGG + Intergenic
1144142168 17:12360286-12360308 AGGGAGCAGGGGAATGAGGAGGG - Intergenic
1144828819 17:18120868-18120890 AGGGAGCCGTAGGGCGAGGCCGG - Exonic
1145797191 17:27662560-27662582 AGGGAGCCGCAGAAGGATGGTGG - Intergenic
1145898418 17:28474196-28474218 AAGCAGCAGCAGAGTGAAGAGGG + Intronic
1147260749 17:39208708-39208730 AGGGAGATGCAGAAAGAGGAGGG - Intergenic
1147277726 17:39333146-39333168 AGGGAGACGGAGAGGGAGGAGGG - Intronic
1147305822 17:39563774-39563796 AGGGAGAGTGAGAGTGAGGAAGG + Intronic
1147916205 17:43888422-43888444 ATGGAGCCCCAGAGTGAGGGAGG + Intronic
1147952231 17:44113679-44113701 AGGGAGGGGCAGAGTGAGTCTGG - Intronic
1148019116 17:44541980-44542002 AGGGAGCCGGGCAGTGAGAAAGG - Intergenic
1148102777 17:45102838-45102860 AGGGAGCCGCCGAATGACCAGGG + Intronic
1148221239 17:45863884-45863906 AGTGTGCTGCAGAGTGGGGAGGG - Intergenic
1148615655 17:48998074-48998096 TGGGAGGCGCAGAGCGAGGGAGG - Intronic
1148867414 17:50635654-50635676 AGGGAGGCCCAGAGAGAGGAAGG + Intronic
1149239052 17:54627120-54627142 CAGCAGCCGCAGAGTGAGGGTGG - Intergenic
1149492115 17:57092482-57092504 AGGGAGCCTGAGAGTAAGGGGGG + Intronic
1149541599 17:57471936-57471958 AGGAAGCCTCTGAGTGAGAAAGG - Intronic
1149848578 17:60021781-60021803 AGGCAGCCTCAGGGTGAGGAAGG + Intergenic
1149861591 17:60124743-60124765 AGGCAGCCTCAGGGTGAGGAAGG - Intergenic
1150478093 17:65489032-65489054 AGGGAGAGGAAGAGAGAGGAAGG + Intergenic
1150997549 17:70336263-70336285 AGGCAGCATCAGAGTGAGGCAGG - Intergenic
1151279933 17:73065882-73065904 AGGGAGGCTCAGAGGCAGGACGG + Intronic
1151362338 17:73596215-73596237 AGGGACCCGCAGGGTGAGTGGGG + Intronic
1151768584 17:76145167-76145189 AGGCAGCAGCTGAGTGAGGATGG + Exonic
1151965222 17:77427685-77427707 AGGCAGGCACAGAGTGTGGATGG - Intronic
1152091457 17:78249864-78249886 AGGGAGGCATAGAGGGAGGAGGG + Intergenic
1152626379 17:81389594-81389616 AGGGACCCCCAGGCTGAGGAGGG - Intergenic
1152742679 17:82025206-82025228 AGGCAGCCTCAGAGGGATGAGGG - Intronic
1152814007 17:82397017-82397039 AGGGAGCAGCTGAGGGAGGCAGG + Intronic
1153361463 18:4202340-4202362 CTGGAGCCTCAGAATGAGGAAGG + Intronic
1153728281 18:7980328-7980350 AGGGGGCAGCAGAGTGAACATGG - Intronic
1154269379 18:12906285-12906307 AGGCAGCTGCAGAGACAGGAAGG - Intronic
1155116502 18:22773556-22773578 AGGAAGCAGGAGAGAGAGGAGGG - Intergenic
1155521462 18:26673049-26673071 AGAGAGCCTAAGAGTGATGAAGG - Intergenic
1156107711 18:33685756-33685778 AGGGAGCAAGAGAGAGAGGAAGG + Intronic
1157009361 18:43627978-43628000 ACGGAGCGGCAGTGGGAGGAAGG - Intergenic
1157687868 18:49657361-49657383 AGGCAGCAGCAGGGTGAGGATGG - Intergenic
1157984572 18:52422514-52422536 AGGTTGCCCCAGAGTAAGGAAGG + Intronic
1158768012 18:60479082-60479104 AGGGAGCAAGAGAGAGAGGAAGG + Intergenic
1158795381 18:60839546-60839568 AGGGAACCACAGAATGAGGATGG + Intergenic
1159122084 18:64182879-64182901 AGGGAGAGGCAGAGGGAGGGAGG - Intergenic
1160254867 18:77239699-77239721 AATGAGGAGCAGAGTGAGGAAGG - Intergenic
1160298583 18:77658746-77658768 AGGAAGGCCCAGTGTGAGGAGGG + Intergenic
1160389274 18:78518068-78518090 GGGGAGCCGCAGTGTGAGGATGG + Intergenic
1160695974 19:484728-484750 TGGCTGCCGCAGGGTGAGGAGGG + Intergenic
1160727588 19:624484-624506 CGGGGGCCGCAGAGAGAGGGTGG - Intronic
1161390640 19:4018685-4018707 AAGGAGCAGCAGAGTGATGTAGG + Intronic
1161397332 19:4051793-4051815 TGGGAGGCCCAGAGAGAGGAAGG + Intronic
1161504683 19:4637497-4637519 ATGGAACCCCAGAGGGAGGAAGG - Intergenic
1161649887 19:5477958-5477980 TGGCTGCAGCAGAGTGAGGAGGG - Intergenic
1161702812 19:5804583-5804605 AGGGGTCCCCGGAGTGAGGATGG + Intergenic
1161756423 19:6137447-6137469 TGGCTGCAGCAGAGTGAGGAGGG + Intronic
1161982949 19:7639340-7639362 AGGGAGCTGCACGGTCAGGAAGG - Intronic
1161998859 19:7730861-7730883 TGGGAGCCGCAGGGTGAGAGGGG + Intronic
1162751190 19:12830392-12830414 AGGGAGCGAGAGAGGGAGGAGGG - Intronic
1162996649 19:14340046-14340068 GGGGAGAAGGAGAGTGAGGAAGG - Intergenic
1163383628 19:16985624-16985646 AGGGAGGCGCAGAGGGAGGGTGG + Intronic
1163718557 19:18886694-18886716 AGGAAGCCGCAGATGGAGGCTGG - Intronic
1164680384 19:30130699-30130721 AGGGAGGAGGAGAGGGAGGAAGG - Intergenic
1164680415 19:30130788-30130810 AGGGAGAAGGAGAGGGAGGAAGG - Intergenic
1164680487 19:30131008-30131030 AGGGAGGAGGAGAGGGAGGAAGG - Intergenic
1164680513 19:30131081-30131103 AGGGAGGAGGAGAGGGAGGAAGG - Intergenic
1164680539 19:30131154-30131176 AGGGAGGAGGAGAGGGAGGAAGG - Intergenic
1165157383 19:33796631-33796653 AGGCCGCCGGAGAGAGAGGAGGG + Intronic
1165171061 19:33891921-33891943 AGGGGGCCACAGGGTGAGCAAGG + Intergenic
1166079618 19:40435423-40435445 GGGGAGCAGAGGAGTGAGGAGGG - Intergenic
1166108860 19:40610869-40610891 ATGGAGAAGCAGAATGAGGAGGG + Intronic
1166184215 19:41128838-41128860 AGGGAGAGGGAGAGGGAGGAGGG + Intergenic
1166233039 19:41436805-41436827 AGGGAGCAGAGGAGTGGGGATGG + Intronic
1166319503 19:42007612-42007634 AGGGAGCTGCAAAGAGAGGGAGG + Intronic
1166338262 19:42121976-42121998 TGGGAGCCCAAGAGTGAGAAGGG + Intronic
1167621963 19:50565753-50565775 AGGGAGCCACAGACTCAGGGAGG - Intronic
1167690353 19:50981092-50981114 AGAGACCCACAGAGAGAGGAGGG + Intronic
1168214006 19:54912042-54912064 TGGGACCCGCAGGGTGAGGTGGG + Intronic
1168518742 19:57031695-57031717 CGGGGGCAGCAGAGGGAGGAAGG - Intergenic
925148612 2:1599801-1599823 AGGGAGCAGCAGGAAGAGGAGGG - Intergenic
925381007 2:3426311-3426333 AGGTAGCCACAGAGTCAAGAAGG + Intronic
926309155 2:11662083-11662105 CTGGAGCTGCTGAGTGAGGAGGG - Exonic
926811012 2:16755427-16755449 ATGGAGCTGCAGAGAGAGGTGGG + Intergenic
927490829 2:23519799-23519821 AGGAAGACCCAAAGTGAGGAGGG + Intronic
927708504 2:25311383-25311405 AGGGAGCCGCCCAGGGAGGGTGG - Intronic
927713311 2:25339047-25339069 AAGGAGAGGCAGTGTGAGGAGGG - Intronic
928125473 2:28612456-28612478 GCTGAGCCCCAGAGTGAGGAAGG - Intronic
928880155 2:36088578-36088600 TGGGACCCGCTGAGTGAGGCTGG - Intergenic
928921483 2:36532715-36532737 AGGAAGTGGCAGGGTGAGGAGGG - Intronic
930096483 2:47570395-47570417 CGGGAGCAGGAGCGTGAGGATGG + Exonic
932259203 2:70312991-70313013 ATGGAGCCCCAGAGTGATGTGGG + Intergenic
933368082 2:81380135-81380157 AGAGAGCAGCAGAGAGAGAATGG + Intergenic
933984003 2:87575620-87575642 AGGGAGGCACTGGGTGAGGAAGG - Intergenic
934517781 2:94999514-94999536 AGGCAGGCGCAGAATGAGGCAGG + Intergenic
935950856 2:108326926-108326948 AGGAAGCCCCAGAATCAGGAAGG + Intergenic
936309851 2:111375176-111375198 AGGGAGGCACTGGGTGAGGAAGG + Intergenic
936644619 2:114354724-114354746 AGGGAGCTACAGAAAGAGGAGGG + Intergenic
937268178 2:120630287-120630309 AGGGGGTGGCAGAGTGGGGAGGG + Intergenic
937278820 2:120703591-120703613 ACTCAGCTGCAGAGTGAGGAAGG - Intergenic
938310814 2:130287186-130287208 AGGGACCCGCAGACCGAGGAAGG + Intergenic
940251173 2:151678659-151678681 AGGGAGACCCAGAGCCAGGAGGG + Intronic
941284869 2:163598231-163598253 TGGGGGAGGCAGAGTGAGGAAGG - Intronic
942245492 2:174004144-174004166 GGGGAGCCCAATAGTGAGGAGGG + Intergenic
944586976 2:201181141-201181163 ATGCTGCAGCAGAGTGAGGAGGG - Intergenic
945431604 2:209771845-209771867 GAGGAGCCGCGGAGCGAGGAGGG - Intergenic
945977554 2:216282526-216282548 AGTGAGCACGAGAGTGAGGATGG - Intronic
946036276 2:216744925-216744947 TGGGAGCTAGAGAGTGAGGAAGG + Intergenic
946475124 2:219999861-219999883 AGGGGGCCGGAGAGTGCGGAAGG - Intergenic
947029942 2:225782598-225782620 AGGGAGAAACAGAGGGAGGAAGG - Intergenic
947542428 2:230988193-230988215 AGGAAGCCACATATTGAGGATGG + Intergenic
947569032 2:231216553-231216575 AAGGAGCCTCAGAGAGAGGATGG + Intronic
948230997 2:236349220-236349242 ATGGAGCTGAAGAGTGAGGAGGG + Intronic
1168811016 20:704597-704619 AGGGAGACCCAAGGTGAGGATGG - Intergenic
1169275908 20:4233699-4233721 AGGGGGCAGAAGAGTGATGATGG - Intronic
1170829679 20:19829442-19829464 AGAGAGCTCTAGAGTGAGGAGGG + Intergenic
1172183005 20:33015005-33015027 ACGGAGGCCCAGAGTCAGGAAGG + Intronic
1172624587 20:36339979-36340001 AGGCAGCCGCAGAGCGGGGAAGG + Intronic
1173837406 20:46134926-46134948 AGGGAGCCCCAGGGACAGGAAGG - Intergenic
1174181954 20:48680550-48680572 TGGCTGCCTCAGAGTGAGGAGGG - Intronic
1175499083 20:59436781-59436803 AGGGAGAGGCAGGGTCAGGAAGG + Intergenic
1175504187 20:59470307-59470329 AGGGATTCGAAGCGTGAGGAGGG - Intergenic
1176049015 20:63106846-63106868 AGCGAGCTGCAGTGTGAGGATGG + Intergenic
1178822859 21:35991336-35991358 ACAGAGCAGGAGAGTGAGGAGGG + Intronic
1179362212 21:40720879-40720901 AGGGAGCTCCAGAGAGCGGAAGG + Intronic
1179680855 21:43020373-43020395 AGGGAGACGCTGTGTGAGGGAGG + Intronic
1180012171 21:45058513-45058535 AGGGGGTCGCAGAGTGGGGAGGG + Intergenic
1180285647 22:10742179-10742201 ATGGAGCCCCAGAGTAAGGGAGG + Intergenic
1181422333 22:22810645-22810667 AAGGAGAGGCAGAGGGAGGAGGG - Intronic
1181704968 22:24644489-24644511 TGGGAGGGGCAGAGGGAGGAGGG + Intergenic
1181885262 22:26017068-26017090 AGGGAGAGGCACAGAGAGGAAGG - Intronic
1182775572 22:32828911-32828933 AGGGGGCCCCACAATGAGGAGGG + Intronic
1182776684 22:32836681-32836703 AGGGAGGTGCTGAGTGAGTAGGG + Intronic
1183343878 22:37296324-37296346 ATGGAGGCCCAGAGTGGGGAAGG - Intronic
1183512419 22:38243902-38243924 AGGGAGCTGCAGACTGTGGTGGG + Intronic
1183912670 22:41091527-41091549 AGGGAGCCACAGGGTGACGCCGG + Intergenic
1183912769 22:41091874-41091896 CGGGAGCCAGAGAGTGCGGAGGG + Exonic
1184155415 22:42663576-42663598 TGGGAGCTGCTGGGTGAGGAAGG + Intergenic
1184541980 22:45132183-45132205 AGGGAGACTGAGGGTGAGGATGG - Intergenic
1184615958 22:45639059-45639081 AGGGTGGCGCAGTGTGGGGACGG + Intergenic
1184851519 22:47124103-47124125 TGGGAGCGGCAGAGAGAGAAGGG + Intronic
1185014123 22:48333593-48333615 AGGGAGCCGTGGTGTCAGGAAGG - Intergenic
1185135796 22:49071415-49071437 AGGGAGGGACAGAGGGAGGAAGG - Intergenic
1185139157 22:49090626-49090648 AAGGTGCTGCAGAGTGAGGCTGG + Intergenic
1185368268 22:50446769-50446791 AGGCAGCCGGGGAGTGGGGAAGG + Exonic
949508016 3:4744873-4744895 AGGGAGACAGAGAGGGAGGAAGG - Intronic
949956102 3:9269878-9269900 AGGGAGGGACAGAGGGAGGAAGG + Intronic
950101582 3:10360118-10360140 TGGGGGCTGCAGAGAGAGGAAGG + Exonic
950644334 3:14368169-14368191 AGGCCTCAGCAGAGTGAGGAGGG - Intergenic
951510922 3:23501153-23501175 AAGGATGCACAGAGTGAGGAAGG + Intronic
952383152 3:32819582-32819604 AAGCAGCCGCAGAGAGAGAAGGG - Intronic
952590149 3:34942640-34942662 AGGGAGGCAGAGAGAGAGGAAGG - Intergenic
952849144 3:37713475-37713497 ATTGAGCCACAGAGGGAGGAGGG + Intronic
953367096 3:42354216-42354238 ATGGAGCCAGAGAGTGGGGATGG - Intergenic
953901838 3:46847911-46847933 AGGGAGCCGGAGAGTGGTGGAGG - Intergenic
954585158 3:51728267-51728289 AGGGAGCAGAAAAGAGAGGAGGG + Intergenic
955717529 3:61846456-61846478 AATGAGCCTCAGAGTCAGGAAGG - Intronic
956418585 3:69060833-69060855 AGGGAGCAAGAGAGAGAGGAGGG - Intronic
956624106 3:71249758-71249780 AGGGAGAGGGAAAGTGAGGAGGG + Intronic
957199100 3:77108985-77109007 TGGGAGCCCAAGAGTGTGGAGGG + Intronic
957792777 3:84960566-84960588 AAGAAGCGGCAGAGAGAGGATGG - Intronic
959263679 3:104112412-104112434 AGGGAATCACAGAGTGAGGATGG + Intergenic
960509716 3:118534493-118534515 ATGGAGCCTCAGAGAGATGATGG + Intergenic
961276590 3:125732081-125732103 AGGGAAGGGCACAGTGAGGAGGG - Intergenic
961279476 3:125754672-125754694 AGGGAGGGGCACAGTGAGCAGGG - Intergenic
961289140 3:125831408-125831430 TGGGAGCAAGAGAGTGAGGAGGG + Intergenic
961612502 3:128152457-128152479 AAGGAGCAGGAGAGGGAGGATGG - Intronic
961829401 3:129615774-129615796 AGGATGCAGCAGAGTCAGGAGGG + Intergenic
961874919 3:130014946-130014968 AGGGAAGAGCAGAGTGAGCAGGG + Intergenic
962012029 3:131401165-131401187 AGGGAGCGACAGAGAGGGGAGGG + Intergenic
962420083 3:135220207-135220229 AGAGAGCAGCTGAGTGAGGAAGG + Intronic
962464914 3:135649188-135649210 AGGAAGCTGCAGTGTGAGGAAGG + Intergenic
962804348 3:138916089-138916111 AGGGATCCGCAGGGAGGGGAAGG + Intergenic
963229834 3:142898469-142898491 AGGGAGGAGCAGAGAGAGGGAGG - Intergenic
964367332 3:155964197-155964219 AAGGAATGGCAGAGTGAGGAAGG - Intergenic
968671278 4:1853109-1853131 GGGGAGGAGCAGAATGAGGAGGG - Intronic
968823839 4:2878080-2878102 TGGGAGTGGCAGAGTGAGGTTGG + Intronic
968949976 4:3685465-3685487 AGGCAGCTGGAGAGTGAGGCTGG + Intergenic
969402759 4:6967874-6967896 AGGCAGCCTCAGGGTGAGCAAGG - Intronic
969484468 4:7464421-7464443 AGGGAGCCGCAGCCTGTGGAGGG + Intronic
969659323 4:8517395-8517417 AGGGAGCAGAAGAGGGAGGGGGG + Intergenic
969715164 4:8864812-8864834 AGGGAGCCGGCGTGGGAGGAGGG - Intronic
969804851 4:9599295-9599317 TGGGAGCAAGAGAGTGAGGAGGG + Intergenic
970505839 4:16729485-16729507 AGAGAGCAGGAGAGGGAGGAGGG + Intronic
971165935 4:24183680-24183702 AGGAAAGAGCAGAGTGAGGAAGG - Intergenic
971261964 4:25065474-25065496 AGGCAGCAGCAGGGTGTGGAGGG - Intergenic
971352056 4:25863291-25863313 AGGGAGCCGGAGGGAGAGGAGGG - Intronic
972266545 4:37465472-37465494 AGGGAGCCCCAGAGAGGGGAGGG + Intronic
972629711 4:40832761-40832783 ATGGAGCTGCAGAGTGTTGAGGG - Intronic
972651273 4:41019945-41019967 AAGGAGTCGAAGAGAGAGGAGGG + Intronic
972753284 4:42014915-42014937 TGGGAGGTGGAGAGTGAGGATGG + Intronic
973723328 4:53747537-53747559 AGGGAGGCTCAGAGTGACGTGGG + Intronic
975933365 4:79553856-79553878 AGGGAGGGACAGAGGGAGGAAGG - Intergenic
976818160 4:89174511-89174533 AAGAAGGGGCAGAGTGAGGATGG - Intergenic
977213310 4:94246606-94246628 GGTGGGCCTCAGAGTGAGGATGG + Intronic
977424797 4:96853856-96853878 AGGGAGTGGCACAGTGAAGAAGG + Intergenic
977795903 4:101164212-101164234 AGGGAGTGGCAGGGTGAGGGTGG - Intronic
981616090 4:146646488-146646510 AGGGAGAGGAAGAGAGAGGAGGG - Intergenic
983739762 4:171114886-171114908 AGGGAGAAGCAGAGTGGGAATGG - Intergenic
984340969 4:178455285-178455307 AGGAAGCAGCTGAGTAAGGAAGG - Intergenic
984959850 4:185086187-185086209 AGGGAGCTGCAGATGGCGGAGGG + Intergenic
985671020 5:1206728-1206750 AGGGACACGCAGCGTGAGGAGGG + Intronic
985774106 5:1831753-1831775 AGGGAGGGGCACAGAGAGGATGG - Intergenic
987149095 5:15020849-15020871 AAGGAGAAGCAGAGAGAGGAGGG + Intergenic
990172033 5:53062273-53062295 AGAGAGCAGGAGAGTCAGGAAGG - Intronic
991258418 5:64640544-64640566 AGGAAGCTGAAGAGGGAGGATGG + Intergenic
991605711 5:68398573-68398595 AGGGGGCCACAGACTAAGGAAGG + Intergenic
991728504 5:69560417-69560439 GGGGAGCCGCAGAGTAGGGAGGG + Intronic
991804935 5:70415564-70415586 GGGGAGCCGCAGAGTAGGGAGGG + Intergenic
991866449 5:71067458-71067480 GGGGAGCCGCAGAGTAGGGAGGG - Intronic
992645382 5:78806927-78806949 AGGGAGCGGAAGAGTAAGCATGG - Intronic
994209316 5:97070515-97070537 AGAGAGCCCAAGAGTGGGGAGGG - Intergenic
995450072 5:112290825-112290847 AGGGAGCTGCAAAGTAAGCAGGG + Intronic
995614827 5:113950194-113950216 TGGGAGCAGCAGAATGAGGGAGG - Intergenic
996472211 5:123873946-123873968 AGTAAGCAGCAGAGTCAGGATGG + Intergenic
996571900 5:124940646-124940668 AGGGAGCTGGAGAGTGTTGATGG + Intergenic
997202573 5:132020719-132020741 AGGGAGGTGCAGGGTGAGTACGG - Intergenic
999694443 5:154176331-154176353 AGGGAGCAAGAGAGAGAGGAAGG - Intronic
1002336949 5:178486235-178486257 AGGCAGCTGCAGAATGAGGACGG + Intronic
1003550934 6:7101461-7101483 CTGGAGCAGCAGAGGGAGGAGGG - Intergenic
1003790666 6:9543843-9543865 AGGGAGCCAGAGAGAGAGGTGGG + Intergenic
1006021850 6:31121990-31122012 AGGGAGCTGTGGAGAGAGGAAGG + Intronic
1006133232 6:31880979-31881001 GGGGAGCAGCAGGGTAAGGAGGG + Intronic
1006253165 6:32807659-32807681 AGGAAGCTGCAGTGTGGGGAGGG + Intergenic
1006642510 6:35496556-35496578 CGGGGGCCGCACAGTGTGGAGGG - Intronic
1006917105 6:37601808-37601830 AGGGAGCCCCAGTCTGTGGATGG - Intergenic
1007243966 6:40446830-40446852 AGGGAGCCCCAGTCTGAGGGGGG - Intronic
1007245917 6:40462499-40462521 AGGGAGCGAAAGAGTGAGGTAGG - Intronic
1007282455 6:40722571-40722593 AGGCAGTCCCAGAGTGGGGAGGG + Intergenic
1007723760 6:43901643-43901665 AGGGAGCCCCAGTCTGAGGGAGG + Intergenic
1007750183 6:44066628-44066650 AGGGAGCCCCAGTCTGAGGGGGG - Intergenic
1007750195 6:44066666-44066688 AGGGAGCCCCAGTCTGAGGGGGG - Intergenic
1007750225 6:44066781-44066803 AGGGAGCCCCAGTCTGAGGCGGG - Intergenic
1009425281 6:63506962-63506984 AGGGAGTAGAAGAATGAGGAAGG + Intergenic
1010562349 6:77366184-77366206 AGGGAGCAAGAGAGAGAGGAAGG - Intergenic
1010642126 6:78341615-78341637 AGAGAGACACAGAGTGAGGGGGG - Intergenic
1013049091 6:106514215-106514237 AGGGAGCAGAAGTGTGAGAAGGG - Intronic
1013139451 6:107317403-107317425 GGAGAGCCCCAGAGTGATGAGGG + Intronic
1013147275 6:107406350-107406372 AGTGAGCTGTAGAGTAAGGAAGG - Intronic
1013394638 6:109722929-109722951 TGGGAGCTGGAGAGAGAGGAAGG + Intronic
1013548613 6:111185030-111185052 AGGAAGCCACAGAGAGATGAAGG - Intronic
1013710508 6:112891901-112891923 AGGAGGCAGGAGAGTGAGGAAGG - Intergenic
1015519124 6:134114122-134114144 ATGCTGCAGCAGAGTGAGGAGGG - Intergenic
1015786054 6:136922348-136922370 CGGGAGCAGCGGAGTGAGGGCGG - Exonic
1016429782 6:143970985-143971007 AGGGAGAGGCAGAGAGTGGAGGG - Intronic
1017092180 6:150769774-150769796 AGGGAGCCTCAGCGAGAAGAAGG - Intronic
1018828069 6:167422973-167422995 AGGGAGCCGCCGTGTGTGGGGGG - Intergenic
1019665465 7:2250026-2250048 TGGGACCCGCATAGTGGGGAGGG - Intronic
1020011341 7:4807506-4807528 GGGGAGACGGAGAGGGAGGAGGG - Intronic
1020098471 7:5381254-5381276 GGAGGGCCACAGAGTGAGGAGGG - Intronic
1020126247 7:5533957-5533979 AGGGAGGGGCAGTGTGAGGCAGG - Intronic
1020531239 7:9338539-9338561 AGGAAGACAAAGAGTGAGGAAGG + Intergenic
1023287128 7:38631477-38631499 GGGGAGCCGCGGAGCGCGGAGGG + Exonic
1023595204 7:41822417-41822439 AGGGAGGAGGAGAGGGAGGAAGG + Intergenic
1024275494 7:47673750-47673772 AGGGGCCCGGAGAGTGTGGAAGG + Intergenic
1024803720 7:53111364-53111386 AGGGAGGCGAAGAGGGAGGGAGG - Intergenic
1025212220 7:57026270-57026292 GGTGAGCTGCAGAGGGAGGATGG + Intergenic
1025659734 7:63550558-63550580 GGTGAGCTGCAGAGGGAGGATGG - Intergenic
1026837259 7:73647375-73647397 AGGGAGAGCCAGAGGGAGGAAGG + Intergenic
1027165311 7:75829978-75830000 AGGGAGCCCCAGGGGGAGGCAGG + Intergenic
1027165832 7:75833766-75833788 AGGGAGCCCCAGGGGGAGGCAGG - Intergenic
1027748310 7:82107427-82107449 AGGGAGAAGCAGAGAGAGGAAGG - Intronic
1029141674 7:98415180-98415202 AGGGAGGGGGAGAGAGAGGAGGG + Intergenic
1029249192 7:99223821-99223843 AGGGAGCGGGGGAGGGAGGAAGG + Intergenic
1029675399 7:102065036-102065058 GGTGAGCTGCAGAGGGAGGATGG + Intronic
1030365499 7:108641358-108641380 AGGGAGGGACAGAGGGAGGAAGG - Intergenic
1032081455 7:128860508-128860530 AGGGGGGCAGAGAGTGAGGATGG - Intergenic
1032520008 7:132536666-132536688 AAGGAGCTGCAGAGAGAGGCTGG + Intronic
1032553170 7:132804893-132804915 CGGGAGCAGCAGTGGGAGGAGGG + Intronic
1033604214 7:142913894-142913916 AGGGAGGGGCAGAAAGAGGAAGG - Intronic
1034162356 7:149002735-149002757 GGGGAGGCGCGGGGTGAGGACGG + Intergenic
1034228712 7:149502175-149502197 AGGGAGGTCCAGGGTGAGGAGGG - Intergenic
1034264449 7:149774100-149774122 AGGGGGCTGCAGAGAGGGGAGGG + Intergenic
1034274273 7:149817220-149817242 AGTGAGCCCCAGAGAGGGGAGGG + Intergenic
1034326891 7:150244675-150244697 AGAGAGCCAGAGAGAGAGGACGG + Intronic
1035359181 7:158298980-158299002 AGGGAACCGCACAGGAAGGAGGG + Intronic
1035442890 7:158918158-158918180 AGGGAGCTGCGTAGTGAGAATGG - Intronic
1035470642 7:159106736-159106758 AGGGAGGGGCAGAGAGAGGCTGG + Intronic
1037769146 8:21788936-21788958 AGGGAGCCGCGAAGGGAGAAGGG - Intronic
1037818779 8:22125611-22125633 AGGCAGCTGGAGAGGGAGGAGGG - Exonic
1038022855 8:23564482-23564504 AGGGAGTCGGGGAGGGAGGAAGG + Intronic
1038401728 8:27289028-27289050 AGGGATCAGCTGAGAGAGGAGGG + Intronic
1039426749 8:37492782-37492804 AGGGAGCCCCAGAGAGCGGAAGG + Intergenic
1039840674 8:41290766-41290788 AGGGAGTCTCTGAGTGAGGGTGG - Intronic
1040333166 8:46402641-46402663 ATGGAGCCGCAGGGTGGCGAGGG + Intergenic
1041729833 8:61052393-61052415 AGGAATCCCCAGATTGAGGATGG + Intergenic
1044551521 8:93517961-93517983 AGGGAGCAAGAGAGGGAGGAAGG + Intergenic
1045017248 8:98010308-98010330 AGAGAGCCCCAGGGTGAGGCTGG - Intronic
1045092500 8:98760785-98760807 AGGGAGCTGTAAAGTGAAGATGG - Intronic
1046230151 8:111345387-111345409 AGGGAGACAAAGAGTGGGGAGGG + Intergenic
1046270882 8:111896734-111896756 TGGGAGCCACAGAGAGAGGAAGG - Intergenic
1047168527 8:122466860-122466882 AGGAAGCTGCAGTGTGGGGAGGG - Intergenic
1047998372 8:130357877-130357899 AGGGAGCCGCCGGGTGAATAAGG - Intronic
1048206297 8:132417924-132417946 AGAGGGCAGCAGAGTGAGGATGG + Intronic
1048345553 8:133572118-133572140 ACGGAGGCGCAGAGTCGGGAGGG - Intergenic
1049128104 8:140810564-140810586 AGGAACCTGCAGTGTGAGGAAGG - Intronic
1049365416 8:142234635-142234657 AGGGAGCTGCAGAGGCTGGAGGG - Intronic
1049475258 8:142794313-142794335 AGGGAGAGGCAGAGGGAGGGTGG - Intergenic
1049650430 8:143764947-143764969 AGGGAGGAGCAGAGTTAGGTGGG - Intergenic
1049673871 8:143881142-143881164 AGTGAGACGCACAGCGAGGAGGG - Intergenic
1051152355 9:14096722-14096744 GGGGAGCCGAAGCGTGAAGAAGG - Intronic
1051563863 9:18473897-18473919 AGCGAGCAGCAGAGCGAGAAGGG - Exonic
1055297821 9:74852446-74852468 AGGGAGAGGGAGAGGGAGGAGGG - Intronic
1056545054 9:87606478-87606500 AGGGAGAGACAGAGGGAGGAAGG - Intronic
1057023840 9:91721285-91721307 AGGAAGCCACAGAATCAGGAAGG + Intronic
1058892757 9:109374999-109375021 ATGGAGCTGTAGACTGAGGATGG + Intergenic
1058987907 9:110225797-110225819 AGAGAGAAGGAGAGTGAGGAGGG - Intergenic
1059694317 9:116716237-116716259 AGGAAGACGGAGAGTGGGGATGG + Intronic
1060269755 9:122132097-122132119 ACGGAGGCTCAGAGAGAGGAAGG - Intergenic
1060477843 9:123999341-123999363 AGGAAGCCGGAGAGGGAGGGAGG + Intergenic
1060830896 9:126715574-126715596 AGAGAGAGGCAGAGAGAGGAAGG + Intergenic
1061007306 9:127935438-127935460 AGGGAGTCTGAGAGTGAGGTTGG + Exonic
1061390463 9:130314864-130314886 ACTGAGGCCCAGAGTGAGGATGG + Intronic
1061489333 9:130936552-130936574 AGGGAGCAGCAGAGGAAGGCGGG + Intronic
1062013412 9:134278926-134278948 AGGAAGCCACAGAGTGTGGTAGG - Intergenic
1062080858 9:134622650-134622672 AGAGAGGGGCAGAGAGAGGAGGG - Intergenic
1062080889 9:134622751-134622773 AGAGAGGGGCAGAGAGAGGAGGG - Intergenic
1062080920 9:134622850-134622872 AGAGAGGGGCAGAGAGAGGAGGG - Intergenic
1062139838 9:134949871-134949893 AGGGAGCCCCAAAGTGGGGCTGG + Intergenic
1062349661 9:136132734-136132756 CAGGAGCCGCACAGGGAGGATGG - Intergenic
1062479296 9:136744058-136744080 CGGGAGCCGCTGAGCGAGGTGGG + Exonic
1203731999 Un_GL000216v2:99245-99267 ATGGAGCCCCAGAGTAAGGGAGG + Intergenic
1186344033 X:8672656-8672678 AGTGAGGAGCAGAGTGCGGAGGG - Intronic
1187402807 X:18976790-18976812 AGGGATCAGGAGAGGGAGGAGGG - Intronic
1187448209 X:19375735-19375757 AGGGTGCTGCAGAGTGTAGAGGG + Intronic
1188009536 X:25041592-25041614 ATGGAGACACAGAGAGAGGATGG - Intergenic
1188314824 X:28660065-28660087 AAGCAGAAGCAGAGTGAGGATGG + Intronic
1188642252 X:32520924-32520946 AGAGAGCTGCAGAAAGAGGATGG - Intronic
1189240317 X:39519706-39519728 AGGGAGCCGGGGAGGGAGGGAGG - Intergenic
1190681409 X:52830047-52830069 AGGGAGACTCAGAGGGAGAAGGG - Intergenic
1190998502 X:55636087-55636109 AGGGAGACTCAGAGGGAGAAGGG - Intergenic
1191993945 X:67069719-67069741 AGGCAGCCAGAGAGAGAGGATGG + Intergenic
1192056371 X:67777872-67777894 AGGGAGCAAGAGAGTGAAGAGGG + Intergenic
1192197288 X:69036926-69036948 GGGGTGCCGCCGAGAGAGGAGGG + Intergenic
1192509293 X:71712508-71712530 AGGGAGACGCACAGGGAGTATGG + Intergenic
1192511427 X:71722654-71722676 AGGGAGACACAGAGGGAGTATGG - Intergenic
1192515270 X:71758851-71758873 AGGGAGACACAGAGGGAGTATGG + Intergenic
1192517404 X:71769045-71769067 AGGGAGACGCACAGGGAGTATGG - Intergenic
1192528488 X:71867742-71867764 AGGGAGACACAGAGAGAGTATGG + Intergenic
1195280341 X:103327241-103327263 TGCAAGCCGGAGAGTGAGGAAGG + Intergenic
1195709713 X:107764413-107764435 AGGGTCCCAGAGAGTGAGGATGG + Intronic
1196439536 X:115705761-115705783 AGGGAGAGGGAGAGAGAGGAAGG - Intergenic
1196982686 X:121232282-121232304 GGGAAGCTGCAGTGTGAGGAGGG + Intergenic
1197163299 X:123347612-123347634 ATGGAGCCTCCGAGTGGGGAGGG - Intronic
1197872225 X:131071241-131071263 AGGGAGCAGCAGTTTGAGGCTGG - Intronic
1198158860 X:133987314-133987336 AGGGAGACAAAGAGAGAGGAAGG + Intergenic
1198554629 X:137779935-137779957 AGGGTGGGGCAGAGTGGGGATGG - Intergenic
1199675146 X:150182322-150182344 AGCCAGAGGCAGAGTGAGGAAGG + Intergenic
1200067048 X:153508908-153508930 GGGGAGCCGCAGAGTCGGGGAGG - Exonic
1200137971 X:153884068-153884090 AGGGAGGCAAAGAGTGAGGAAGG - Intronic
1200310539 X:155072452-155072474 AGGGAGCCCCGGAGTGATAATGG - Intronic
1201452837 Y:14135010-14135032 AGGTAGCCTCAGAGGAAGGAAGG - Intergenic
1201461533 Y:14230782-14230804 AGGGAGACAGAGAGGGAGGAAGG + Intergenic