ID: 1123691119

View in Genome Browser
Species Human (GRCh38)
Location 15:22838869-22838891
Sequence TGCCCAAGGCTGCGCCGGCG AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 109
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 101}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1123691114_1123691119 1 Left 1123691114 15:22838845-22838867 CCTGTGTGGGGGTGTGAGCCGCG 0: 1
1: 0
2: 2
3: 7
4: 105
Right 1123691119 15:22838869-22838891 TGCCCAAGGCTGCGCCGGCGAGG 0: 1
1: 0
2: 0
3: 7
4: 101
1123691108_1123691119 25 Left 1123691108 15:22838821-22838843 CCGTGCGAGCGCAGGACTGGGCG 0: 1
1: 0
2: 0
3: 4
4: 57
Right 1123691119 15:22838869-22838891 TGCCCAAGGCTGCGCCGGCGAGG 0: 1
1: 0
2: 0
3: 7
4: 101

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1123691119 Original CRISPR TGCCCAAGGCTGCGCCGGCG AGG Exonic
902044277 1:13513560-13513582 AGCCCCAGCCTGCGCCGCCGCGG - Exonic
902715592 1:18270449-18270471 TGCCCGAGGCTGCCCTGGAGAGG - Intronic
904252933 1:29237670-29237692 TGCCCGAGGCGGCGGCCGCGGGG - Intronic
904775180 1:32901705-32901727 GGCCCAAGGCTGGGACGGAGAGG + Intergenic
905048953 1:35031938-35031960 AGACCAAGGCTGCGCAGGCGTGG - Exonic
906719693 1:47996552-47996574 CGCCCGAGGCTGCGCCCGGGGGG + Intronic
907200972 1:52726588-52726610 GCCCCCAGGCTGAGCCGGCGCGG - Exonic
907200996 1:52726665-52726687 TCACCATGGCTGCGCCGGCCTGG - Exonic
907523406 1:55039759-55039781 GGCTCAAGGCGCCGCCGGCGTGG + Exonic
907577340 1:55539159-55539181 TGCCCAAGGTTGCACAGGTGAGG - Intergenic
913109328 1:115642794-115642816 TGGCGAAGGCTGCCCCGGCGCGG - Intronic
913565640 1:120069725-120069747 TGCCCAAGGCGGCGGGGCCGAGG - Intergenic
913632489 1:120723828-120723850 TGCCCAAGGCGGCGGGGCCGAGG + Intergenic
914286236 1:146229099-146229121 TGCCCAAGGCGGCGGGGCCGAGG - Intergenic
914547264 1:148679841-148679863 TGCCCAAGGCGGCGGGGCCGAGG - Intergenic
914619239 1:149390502-149390524 TGCCCAAGGCGGCGGGGCCGAGG + Intergenic
915591997 1:156875971-156875993 TGCACAAGGCTGCCCAGACGAGG - Intronic
918580384 1:186120102-186120124 TGCCCAAGGCTGTACCAGCCGGG - Exonic
1067083395 10:43225922-43225944 GGCCCAAGGCTGGGCAGGGGTGG + Intronic
1076359343 10:129875877-129875899 TGCCCAGGGCTGGGCCTGGGAGG - Intronic
1076402088 10:130190968-130190990 TCCCCAAGCCTGGGCCGGCTTGG + Intergenic
1076738544 10:132469346-132469368 TGACCAGGGCTGCCCCAGCGAGG + Intergenic
1079205635 11:18412241-18412263 TGCCCGCGCCTGGGCCGGCGGGG + Intergenic
1083570756 11:63761301-63761323 GGCCCAAGGCTGCCTCGGCAGGG - Exonic
1084387871 11:68855385-68855407 TGACCCAGGCTGCGCCCGGGTGG + Intergenic
1085526862 11:77169263-77169285 TGCCCACGGCTGCCCCAGGGAGG - Intronic
1089693358 11:120200167-120200189 TGCCAAAGGCTGTGCCTGGGAGG + Intergenic
1091383488 12:77804-77826 TTCCCCAGGCTGGCCCGGCGAGG - Intronic
1096103068 12:48980961-48980983 TGCCCAACCCTGCTCCGCCGCGG - Intronic
1103974660 12:124694678-124694700 TGCCCAAAGCTGCACAGGCTGGG - Intergenic
1104001608 12:124863918-124863940 AGCCCAAGGCTGCCCGGGGGCGG - Intronic
1105785157 13:23740949-23740971 TGTCCAAGGCTGCCCAGGAGAGG + Intronic
1113950439 13:114068553-114068575 TCCCCAAGGCTGCGCTGCAGTGG - Intronic
1118461500 14:65991282-65991304 TGCCCAAGGGTGTGGCAGCGTGG - Intronic
1118725914 14:68628846-68628868 TGCCCGAGGCTGTGCGGTCGGGG - Intronic
1122965089 14:105119735-105119757 TGCACAAGGCTGGGCCTGTGAGG + Intergenic
1123691119 15:22838869-22838891 TGCCCAAGGCTGCGCCGGCGAGG + Exonic
1125752223 15:42036723-42036745 TGCCCCAGGCTGCGAAGGAGGGG + Intronic
1127488187 15:59438233-59438255 TGCCCATGTCCTCGCCGGCGCGG - Exonic
1127834950 15:62783408-62783430 CCCCCAGGGCTGCGCTGGCGAGG + Intronic
1133218523 16:4307840-4307862 GGCCCAAGCCTCCGCCGGGGCGG - Intergenic
1141505940 16:84478751-84478773 TGCCCAGGGCTGCTCCCGAGGGG - Exonic
1142143086 16:88481242-88481264 TGGCCAAGGCTGCACCTGCCTGG - Intronic
1143003772 17:3813401-3813423 TGCCCAAGGCTGCACTGTGGTGG - Intronic
1143187955 17:5021942-5021964 TGCCCAAGGGTGCGCTGTTGGGG + Intronic
1145709970 17:26962926-26962948 TGCAAAAAGCTGCGGCGGCGGGG - Intergenic
1152460105 17:80438181-80438203 TCCCCAAGGCTGCTCTGGGGAGG + Intergenic
1159021233 18:63144873-63144895 TGCCCAGGGCGGCGGGGGCGGGG - Intronic
1160225609 18:77008763-77008785 TGTCCAGGGCTGCACCGCCGCGG - Intronic
1162125139 19:8495528-8495550 TGCACAAGGCTGGCCCGGCGTGG - Intronic
1163495332 19:17643300-17643322 TGCCCATGGCTGGCCGGGCGCGG - Intronic
1168294670 19:55372928-55372950 GGCCCAAGGCTGCGTCAGTGAGG + Intergenic
925147229 2:1589220-1589242 TGCCCAGGTCTGCGCAGGCCTGG - Intergenic
926211348 2:10873008-10873030 TGCCCAAGGCTGTGCCTCTGAGG - Intergenic
926294556 2:11559530-11559552 TGCCCTTGGCTGCGACGGTGCGG + Intronic
932417150 2:71580331-71580353 AGCTCAAGCCTGGGCCGGCGAGG + Intronic
934993148 2:98935757-98935779 TGCCCAGGGCTTCGGCGGCGGGG + Intronic
936399692 2:112155914-112155936 TGCCAAAGGCTGCGCTGGGAAGG - Intronic
938651546 2:133388800-133388822 TGAGCAAGGCTGCGTGGGCGTGG + Intronic
945201218 2:207283537-207283559 TGCCCAAGGCTGCACTGCTGGGG + Intergenic
946407020 2:219497224-219497246 TGCCCAGAGCTGGGCTGGCGGGG - Intronic
1176281690 20:64316983-64317005 TTCCCCAGGCTGGCCCGGCGAGG + Intergenic
1176553057 21:8238464-8238486 TGCCCAAGGCCCCGCCTCCGGGG + Intergenic
1176571979 21:8421488-8421510 TGCCCAAGGCCCCGCCTCCGGGG + Intergenic
1176579888 21:8466071-8466093 TGCCCAAGGCCCCGCCTCCGGGG + Intergenic
1182559365 22:31147726-31147748 TGCCCAAGGCTGCCCAGGAGGGG - Intergenic
1183591369 22:38781114-38781136 TGCCCAGGGCTGGGCCAGGGAGG - Intronic
1183903297 22:41022028-41022050 CGCCCAGGGCTGGGCCGGAGGGG + Intergenic
1184690816 22:46116535-46116557 TGGCCCAGGCTGCCCAGGCGGGG - Intergenic
1185014375 22:48334606-48334628 TGCCCAGGGCTGAGCCGGGCTGG + Intergenic
1203258055 22_KI270733v1_random:155506-155528 TGCCCAAGGCCCCGCCTCCGGGG + Intergenic
951853776 3:27171544-27171566 AGCTCAAGGGTGGGCCGGCGGGG - Intronic
954371435 3:50171374-50171396 GGCCCAAGGCTGCGCAGGGTTGG + Intronic
961003741 3:123391005-123391027 TGCCCAAGGCTGGGTCAGCACGG - Intronic
966808665 3:183825284-183825306 GGCCCAAGGATCCGCCGCCGGGG - Exonic
967171547 3:186826544-186826566 TCCCCAAGGCTGCTCCAGCAGGG + Intergenic
967859798 3:194141876-194141898 TGCCCACTCCTGCCCCGGCGTGG - Intergenic
968985250 4:3871444-3871466 TGCCCTGGGGTGCGCCGGGGTGG + Intergenic
970523577 4:16909531-16909553 TCCCCAAGCCTGCGCCTTCGTGG + Intergenic
976180141 4:82391089-82391111 TGCCAAAGGCTGGCCGGGCGCGG - Intergenic
981008753 4:139902856-139902878 TGACCAAGGCTGAGCCCGGGTGG + Intronic
989170068 5:38465104-38465126 TTCCCAAGGCTGTGCAGGGGTGG + Intergenic
991054452 5:62306354-62306376 TGCCCGCGGCCGCGCCGGCCCGG - Intronic
995724673 5:115170235-115170257 TGCCGAGGGCGGCGCCGGGGCGG + Intronic
998399910 5:141843265-141843287 TGCCCCAGGCTGGGCTGGCCAGG - Intergenic
999242465 5:150135928-150135950 CTCCCAAGGCTGAGCCTGCGAGG + Intronic
1007538791 6:42621749-42621771 TGGCCAAGGCTGGCCTGGCGCGG - Intronic
1019305675 7:333185-333207 TGCCCAGGGAGGGGCCGGCGGGG + Intergenic
1019639457 7:2095719-2095741 CGCACAAGGCTCAGCCGGCGGGG + Intronic
1020064532 7:5177271-5177293 TGCCCAAAGCTGCGCCTTCTCGG + Intergenic
1022206715 7:28171555-28171577 TGCCCACAGCTGCACCAGCGGGG - Intronic
1024670026 7:51585807-51585829 TACCCAAGGCTGCGCCCTGGGGG - Intergenic
1034440541 7:151083522-151083544 TGCCCCGGGCCGCGGCGGCGGGG - Intronic
1035751893 8:2002220-2002242 TGCCCGAGGGCGCGCCGGCGCGG + Exonic
1037752938 8:21694414-21694436 TGCAGAAGGCTGGGCCGGTGGGG - Intronic
1038697279 8:29817798-29817820 TGCCCAAAGCTGCACAGGTGTGG + Intergenic
1041044986 8:53880389-53880411 AGGCCTAGGCTGCGCCGGGGTGG + Intronic
1045486643 8:102636675-102636697 TGCCCATGGCAGGGCAGGCGAGG - Intergenic
1057716810 9:97502024-97502046 TGGCCAGGGCTGCGCGCGCGGGG - Intronic
1058866507 9:109166718-109166740 TGCCCAGGCCTCCGCCGGCCTGG - Intronic
1060598356 9:124861694-124861716 TGCCCAAGGCACGGCCGGCGAGG - Intronic
1061903697 9:133685793-133685815 TGCCCAAGGCAGAGCCGGATTGG + Intronic
1062532407 9:137007712-137007734 TGCCAAAGGCTGACCCGGCCCGG - Exonic
1062658326 9:137615367-137615389 TGCCCAAGGCGAGGCCGGTGAGG - Exonic
1062733468 9:138121652-138121674 AGCCCACGGCTGAGCCGGCCTGG - Exonic
1203474249 Un_GL000220v1:137529-137551 TGCCCAAGGCCCCGCCTCCGGGG + Intergenic
1196046357 X:111260250-111260272 TGCCCAAGAATGGGGCGGCGGGG + Intronic
1197819256 X:130529308-130529330 TGCCCAGGGCTGAGAGGGCGGGG - Intergenic
1197819291 X:130529444-130529466 TGCCCAGGGCTGAGACGGCAGGG - Intergenic