ID: 1123692521

View in Genome Browser
Species Human (GRCh38)
Location 15:22850398-22850420
Sequence CTCACCCCTGATTTGCCGCT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 83
Summary {0: 1, 1: 0, 2: 2, 3: 7, 4: 73}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1123692521_1123692524 8 Left 1123692521 15:22850398-22850420 CCAAGCGGCAAATCAGGGGTGAG 0: 1
1: 0
2: 2
3: 7
4: 73
Right 1123692524 15:22850429-22850451 GTCTTCTCATTGAATCATACAGG 0: 1
1: 0
2: 1
3: 18
4: 155
1123692521_1123692525 29 Left 1123692521 15:22850398-22850420 CCAAGCGGCAAATCAGGGGTGAG 0: 1
1: 0
2: 2
3: 7
4: 73
Right 1123692525 15:22850450-22850472 GGAACGATAATGCACCTTAATGG 0: 1
1: 0
2: 0
3: 2
4: 50
1123692521_1123692526 30 Left 1123692521 15:22850398-22850420 CCAAGCGGCAAATCAGGGGTGAG 0: 1
1: 0
2: 2
3: 7
4: 73
Right 1123692526 15:22850451-22850473 GAACGATAATGCACCTTAATGGG 0: 1
1: 0
2: 0
3: 1
4: 37

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1123692521 Original CRISPR CTCACCCCTGATTTGCCGCT TGG (reversed) Intronic
902275191 1:15334597-15334619 CTCAGTCCTCATATGCCGCTAGG - Intronic
903944907 1:26956254-26956276 CTAACCCCAGATTTGGCACTTGG + Intronic
906257252 1:44359706-44359728 CTCCACCCTGATTTGCCCCCGGG + Intergenic
908260846 1:62338486-62338508 CTCACCCCTGAGTCACCACTGGG - Intergenic
910209505 1:84778678-84778700 CTCACTCCTGCTATGCCGCCTGG - Intergenic
912547683 1:110462784-110462806 CTCACTCCTGATGTGCCCCAGGG - Intergenic
920080447 1:203369076-203369098 CTGACACCTGATTTTCCACTAGG + Intergenic
920725228 1:208428663-208428685 CTCAGCCCTGAGTTGCCTCTAGG + Intergenic
921122321 1:212147817-212147839 GTCACTACTGATTTGCCACTTGG + Intergenic
1064857364 10:19784795-19784817 TTCATTCCTGATTTGCCTCTGGG - Intronic
1065284328 10:24173029-24173051 CTCACCCCTGCTGTGCAGCCTGG - Intronic
1067480750 10:46595963-46595985 CTGACCCTTGATTTGGAGCTTGG - Intergenic
1067613989 10:47745838-47745860 CTGACCCTTGATTTGGAGCTTGG + Intergenic
1071629397 10:87205813-87205835 CTGACCCTTGATTTGGAGCTTGG + Intergenic
1077148226 11:1055395-1055417 GTCACCCCTCATTTTCCTCTGGG + Intergenic
1088226891 11:107630313-107630335 CTAACCCCTGATTTTCTCCTGGG + Intronic
1088945797 11:114511489-114511511 CTCAGCCCTGGATTGCCTCTGGG + Intergenic
1089335164 11:117717904-117717926 CTCACCCCTCATTTCCTCCTGGG - Intronic
1089572494 11:119419776-119419798 GTCATCCCTGTTTTCCCGCTGGG + Intronic
1089999041 11:122937869-122937891 CTCGCCCCTGATTGGTAGCTTGG + Intronic
1094022713 12:25931080-25931102 CTCACCCCTGGTTTGGCTTTTGG + Intergenic
1095975044 12:47934461-47934483 CTCACCACTGAATTCCAGCTTGG + Intronic
1097642292 12:62196963-62196985 CTCACCCCTGCTGTGAGGCTGGG - Intronic
1098458883 12:70709705-70709727 TTCATTCCTGATTTGCCTCTTGG - Intronic
1099817825 12:87670662-87670684 TTCACCTCTGATTGGCTGCTGGG - Intergenic
1101701924 12:107181999-107182021 CTCACCCCTTATTTCATGCTGGG - Intergenic
1103196519 12:119048271-119048293 CTCACCCCTGATTTGGAACTGGG - Intronic
1107696147 13:43002164-43002186 CTCACAGCTGATATGCAGCTGGG - Intergenic
1113650564 13:112031520-112031542 ATTACTCCTGATTTGCAGCTGGG + Intergenic
1114377572 14:22164704-22164726 CTGACCCCTAATCTGCCCCTTGG - Intergenic
1115179879 14:30611225-30611247 CTCAACCCTGAGTTTCAGCTGGG - Intronic
1123692521 15:22850398-22850420 CTCACCCCTGATTTGCCGCTTGG - Intronic
1125931757 15:43605108-43605130 CTGGCCCCTGTTTTGCCTCTGGG - Intronic
1128721169 15:69949612-69949634 CTTACCCTTGTGTTGCCGCTTGG - Intergenic
1129108937 15:73326348-73326370 CTCAGCCCTCATTTGCCCGTGGG - Intronic
1136070474 16:27784344-27784366 CCCTCCCCTGATTGGCCCCTGGG + Intergenic
1138959168 16:62008301-62008323 CTCACCCTCTATTTGCCACTTGG + Intronic
1151849000 17:76678652-76678674 CTCAGCCCTGCTCTGCAGCTGGG + Intronic
1152334452 17:79692551-79692573 CTCACCCCTGATTTACAGATGGG - Intergenic
1155084986 18:22449540-22449562 TTCACTCCTGATTTGGCTCTTGG - Intergenic
1160216977 18:76940839-76940861 CTCACCCCTGCTGTGCGGCCTGG - Intronic
934919716 2:98332967-98332989 TTCACCCCTGATTTGCTGTTTGG + Intronic
937043592 2:118838917-118838939 CTCACCCCTGCCTTGTAGCTTGG + Intergenic
943587868 2:189761832-189761854 CTGACCCCTGTTTTCCCCCTTGG - Intronic
1168832758 20:855763-855785 CCCACCCCTGATTTGCCAACAGG - Intronic
1172386886 20:34540270-34540292 CTCACCCCTGTTTTCCAGGTGGG - Intronic
1172620097 20:36313092-36313114 CTCACCCCTGACCTGCCGCCTGG + Intronic
1175575607 20:60058363-60058385 CTCACCCCTGATCTGCCGGTTGG - Intronic
1175786669 20:61716309-61716331 CTCACCCATGAGCTGCCTCTTGG + Intronic
1175958663 20:62624090-62624112 CACACCCCTGATCTGCAGGTGGG - Intergenic
1176132030 20:63500253-63500275 CTCAGCCCTGAGTTCCCACTGGG + Intergenic
1178274919 21:31228505-31228527 TTCACCCATGATTTGCTGCTGGG - Intronic
1178823766 21:35998341-35998363 CTTACCCCTCTCTTGCCGCTAGG - Intronic
1179389225 21:40972319-40972341 TCCACCCCTGATTTGCCTCAGGG + Intergenic
1184765682 22:46570840-46570862 CCCTCCCCAGATTTGCCCCTCGG - Intergenic
956477652 3:69640121-69640143 CTCATTCCTGATTTGGCTCTTGG - Intergenic
961628167 3:128277999-128278021 CTCACCCCACATTTGTCTCTGGG - Intronic
961829838 3:129617819-129617841 CTCACCCCAGACTTGCAGATGGG - Intergenic
964951746 3:162303355-162303377 CTCTCCCCTGATTTTTCCCTTGG - Intergenic
965106424 3:164361112-164361134 CTCACCTCTGCTGTGCCGCTTGG - Intergenic
974326683 4:60423197-60423219 TTCACCCCTGATTTTTCTCTTGG - Intergenic
975575774 4:75861083-75861105 CTCACCAATGATTTTCAGCTGGG + Intronic
982077908 4:151757236-151757258 ATCACCTTTGATTTGCTGCTGGG - Intronic
984380585 4:178987534-178987556 CTCACTCATGATTTGGCTCTCGG + Intergenic
988455279 5:31381893-31381915 CTCACCCCTCAGTGTCCGCTGGG - Intergenic
990081077 5:51914240-51914262 CTCACCACTGCTTTGAAGCTTGG + Intergenic
994407470 5:99363204-99363226 CTCAACACTGATTTGCCTTTAGG + Intergenic
999503539 5:152170708-152170730 CTCACCCCTGAATCCCCACTGGG - Intergenic
1001178745 5:169498320-169498342 CTAACCCCTCATTTGCATCTGGG - Intergenic
1001940791 5:175738161-175738183 CTGACCCTTGATGTGCTGCTGGG - Intergenic
1007720820 6:43884601-43884623 CTCTCCCCTAAATTGCCTCTTGG + Intergenic
1019115595 6:169759260-169759282 GTCACCCCTGAATTGCCTTTGGG - Intronic
1019530363 7:1500062-1500084 CCCACCCCAGCTTTGCCTCTGGG - Intronic
1024813086 7:53236123-53236145 CTCACCCCTGATTTTCCTCTTGG + Intergenic
1031378348 7:121054644-121054666 CTCAACCCTGATTTGCAGTGGGG - Intronic
1035017770 7:155781603-155781625 CGCTCCCCAGATTGGCCGCTGGG + Intergenic
1041463745 8:58138712-58138734 CTCCCTCCTGACTTGCCACTTGG + Intronic
1043239873 8:77919066-77919088 CTCTCCCCTGATTTTTCCCTAGG - Intergenic
1061241348 9:129375216-129375238 CAGACCCCTGAGTGGCCGCTGGG + Intergenic
1062638147 9:137502228-137502250 CTCACCCTTGGTTTGCCCCAGGG - Intronic
1186623103 X:11262551-11262573 CTCACCCCTTGTTTGGCCCTGGG - Intronic
1200011791 X:153125640-153125662 CTCACCCCTGACCTGTCGCCGGG + Intergenic
1200027810 X:153274279-153274301 CTCACCCCTGACCTGTCGCCGGG - Intergenic