ID: 1123692525

View in Genome Browser
Species Human (GRCh38)
Location 15:22850450-22850472
Sequence GGAACGATAATGCACCTTAA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 53
Summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 50}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1123692521_1123692525 29 Left 1123692521 15:22850398-22850420 CCAAGCGGCAAATCAGGGGTGAG 0: 1
1: 0
2: 2
3: 7
4: 73
Right 1123692525 15:22850450-22850472 GGAACGATAATGCACCTTAATGG 0: 1
1: 0
2: 0
3: 2
4: 50

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1123692525 Original CRISPR GGAACGATAATGCACCTTAA TGG Intronic
908626564 1:66050792-66050814 GTAACGATGATGCTCCTTCACGG - Intronic
909132406 1:71754341-71754363 GAAACGCTAATGTATCTTAAAGG - Intronic
915201745 1:154234998-154235020 GGAATGGTAATGTGCCTTAATGG - Intronic
923092278 1:230749711-230749733 GGGACAATAATGCAACTTATGGG + Intronic
1070817214 10:79332082-79332104 GGAGAGATAATGCACCTTCTGGG + Intergenic
1071605912 10:86989107-86989129 GGAAAGATATTCCACCTTCATGG - Intergenic
1082704342 11:56475343-56475365 GGAAATATTATGCACCTTACTGG - Intergenic
1089738334 11:120564682-120564704 GGAATACTAATGCACCCTAAAGG + Intronic
1101101243 12:101395234-101395256 GGAAAGATAATTCATTTTAAGGG + Exonic
1110914582 13:81006004-81006026 GGAAAGATATTCCACGTTAATGG - Intergenic
1111206970 13:85023242-85023264 GGAAAGATAATGCACCAAATGGG - Intergenic
1111379075 13:87422333-87422355 GCAACAATAATGCACATCAATGG - Intergenic
1120055677 14:79921268-79921290 GGAAAAATAGTGCACTTTAATGG + Intergenic
1123692525 15:22850450-22850472 GGAACGATAATGCACCTTAATGG + Intronic
1130397058 15:83511932-83511954 GGAACAATACTGGACCTAAAAGG + Intronic
1130525929 15:84706245-84706267 GGAACCATTATGTCCCTTAATGG - Intronic
1137924349 16:52525772-52525794 GCAGTGATAATGCACTTTAATGG + Intronic
1138681618 16:58687644-58687666 GAAACTAAAATGCACCTTATTGG - Intergenic
926356258 2:12043419-12043441 GGAAAGATGATGCATCTTGATGG + Intergenic
928924020 2:36557866-36557888 ACAAAGATAATGCACCTTCAAGG - Intronic
930573280 2:53113353-53113375 GGAACATTTATGGACCTTAAAGG + Intergenic
931980023 2:67684935-67684957 GGAGCTATAATGCTCCTTAATGG - Intergenic
932910706 2:75803324-75803346 GGAAGGATAAAGTAACTTAAAGG + Intergenic
933028519 2:77294586-77294608 GGCAGGAGAATGCACATTAATGG + Intronic
937538016 2:122914764-122914786 GCAATGAAAATACACCTTAATGG - Intergenic
1169740379 20:8887224-8887246 GGAACGATATTGCATGTTCATGG - Intronic
1174609940 20:51790722-51790744 GGTGCGATAATGCATCTTGAGGG + Exonic
1180065888 21:45412097-45412119 GGAAAGAGAATGCACCTGCAGGG - Intronic
1185141539 22:49105184-49105206 GGAGCGTTAATGCACCTCTATGG - Intergenic
956633482 3:71339381-71339403 GGAATGATAATGTACCTTAGAGG - Intronic
962434953 3:135357644-135357666 GGCAAGATAATTCATCTTAAGGG - Intergenic
970075863 4:12218956-12218978 AGAACGATAAGGGACATTAATGG + Intergenic
974568827 4:63616736-63616758 GGAAATATAATGCTGCTTAAAGG - Intergenic
977056914 4:92204126-92204148 GAAACTATAAAGCAACTTAAAGG + Intergenic
977349606 4:95864840-95864862 GGAAAGATAACACACATTAATGG - Intergenic
981566387 4:146105951-146105973 GGAACAATCATGAACCTTCAAGG + Intergenic
984432542 4:179666642-179666664 GCAACAATGATACACCTTAAAGG + Intergenic
988330849 5:29837859-29837881 AGAACAACAATCCACCTTAATGG + Intergenic
989803810 5:45579962-45579984 GGAAGGATATTGCATCTAAATGG - Intronic
993264481 5:85706642-85706664 GTAAATATAATTCACCTTAATGG + Intergenic
1000044747 5:157512944-157512966 GGAACCTTAAAGAACCTTAAAGG + Intronic
1008433669 6:51450077-51450099 GGAAAGATAGTTTACCTTAAAGG - Intergenic
1014355303 6:120401117-120401139 GGAAAGATAATCCATGTTAATGG - Intergenic
1014833386 6:126128878-126128900 GAAAAGAAAATGCACCTAAAAGG + Intergenic
1031003743 7:116448166-116448188 AGAGAGATAATGCAGCTTAATGG - Intronic
1035975198 8:4302577-4302599 TATACGATAATGCACCGTAAGGG + Intronic
1039783212 8:40808357-40808379 GTAATGAAAATGCAGCTTAAGGG + Intronic
1040750540 8:50700695-50700717 GGAACGATAAATCATCTTGAGGG - Intronic
1044957372 8:97495287-97495309 GGAAAGATATTCCACATTAATGG + Intergenic
1048079820 8:131113762-131113784 GGAAAGATAATCCATTTTAATGG - Intergenic
1050845425 9:10211292-10211314 GGAAAAATAATGCATCTTCAAGG + Intronic
1051601540 9:18879208-18879230 GGAACCTAAAAGCACCTTAAAGG + Intronic
1201419548 Y:13783208-13783230 GAAGTTATAATGCACCTTAAGGG + Intergenic