ID: 1123693552

View in Genome Browser
Species Human (GRCh38)
Location 15:22859693-22859715
Sequence CAAGATCCAGACATCAATAT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 174
Summary {0: 1, 1: 0, 2: 0, 3: 15, 4: 158}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1123693552 Original CRISPR CAAGATCCAGACATCAATAT GGG (reversed) Intronic
905245023 1:36606753-36606775 CAAGGGCCAGACATGAATGTTGG + Intergenic
909890263 1:80996547-80996569 CCATACCCAGACATGAATATAGG + Intergenic
911352343 1:96769046-96769068 CAAGATACAGTCATAAATCTTGG + Intronic
911582791 1:99653604-99653626 CTAGATGCAGACATAATTATTGG + Intronic
913465443 1:119137161-119137183 CAAAATCAAGAAATTAATATTGG - Intronic
916156838 1:161859241-161859263 CAATATGCAGAGATGAATATAGG - Intronic
916991778 1:170252151-170252173 CTAGATCCAGTACTCAATATTGG + Intergenic
918157622 1:181864668-181864690 TAAGAAGCAGACATCAAGATGGG - Intergenic
920070969 1:203303020-203303042 CAAGATATAGACAGCTATATAGG - Intergenic
920193241 1:204208885-204208907 CAACATACAGCCATCAAAATTGG + Intronic
920995058 1:210982155-210982177 CAACATCCACACAGGAATATTGG + Intronic
921496591 1:215850047-215850069 CAAGATCCAGAACTCAAGATTGG + Intronic
922199694 1:223391681-223391703 CAAGATCAAGACATCAGATTTGG + Intergenic
923071994 1:230574121-230574143 CAAAATTCTGACATGAATATGGG + Intergenic
1063394781 10:5676835-5676857 CAAGAAACAGACACCAAGATGGG + Intergenic
1063786436 10:9390476-9390498 CAAGAGCCATACATTAATTTTGG + Intergenic
1065388298 10:25156088-25156110 CAAGATCTAGAGAAGAATATTGG + Intergenic
1066339004 10:34511002-34511024 TAAGATCCAGACATTATGATTGG + Intronic
1068483939 10:57631950-57631972 AAAGAGCCAGATATCAATACAGG - Intergenic
1069557095 10:69405696-69405718 CAAGATCCTGACATCACTTCTGG - Intronic
1069881002 10:71593164-71593186 CCAGACCCAGATATAAATATGGG + Intronic
1070670350 10:78373274-78373296 CAAGAAGCAGACACCCATATGGG - Intergenic
1071407395 10:85351342-85351364 CAATATCCAGATACCAATATTGG + Intergenic
1071778083 10:88811396-88811418 CAATATCCACACCTCAGTATTGG - Intronic
1075090054 10:119439148-119439170 CAAGATCCTGTCATCAAGAGAGG + Intronic
1075977764 10:126710959-126710981 CAATTTCCAGAGTTCAATATGGG + Intergenic
1076527396 10:131120689-131120711 CAAGATCCAAACCTCTATGTGGG + Intronic
1080013665 11:27482976-27482998 TGAGAAGCAGACATCAATATGGG + Intergenic
1085011705 11:73145850-73145872 CATGTTCCAGACATTAAAATAGG + Intergenic
1086613162 11:88781472-88781494 GTACATCCAGACATAAATATGGG - Intronic
1090298520 11:125612503-125612525 GTAGATCAAGACATCAATTTAGG - Intronic
1092576942 12:9795270-9795292 CAGGGTCCAGGCATAAATATGGG - Intergenic
1096803087 12:54124456-54124478 CTAGAGCCAGAGATCAATATGGG + Intergenic
1097889402 12:64761866-64761888 CCTGATCCAGACATCAAGAAAGG - Intergenic
1101020157 12:100545793-100545815 CAAGAAGCAGATATCAACATGGG + Intronic
1104152289 12:126095317-126095339 CAAACTCCAGTCATCCATATTGG - Intergenic
1105428034 13:20312650-20312672 CAAGAAGCAGACACCAAGATGGG - Intergenic
1105776206 13:23663314-23663336 CAACATATAGACATCAATAAAGG - Intronic
1107032909 13:35871353-35871375 CAAAAACCACACATCATTATGGG + Intronic
1108254463 13:48597027-48597049 CCAGATCCAGACCCCAATAGAGG - Intergenic
1111140334 13:84109785-84109807 CAAGATCAACACATCAAACTAGG - Intergenic
1111902829 13:94220626-94220648 CAAGATCAAGGCATCAACAAGGG + Intronic
1114057646 14:18987178-18987200 CAAGAACCAGAAATAAATAAGGG + Exonic
1114104900 14:19414575-19414597 CAAGAACCAGAAATAAATAAGGG - Exonic
1118775031 14:68968503-68968525 AAAGATACAGACAGCTATATAGG + Intronic
1119895084 14:78213315-78213337 CAAGAAGCAGACATCAAAACAGG + Intergenic
1120267227 14:82266288-82266310 CAAGATCCAGTCCTGAATAAGGG + Intergenic
1120549625 14:85853904-85853926 CTAGATACAGATATCGATATAGG + Intergenic
1121155178 14:91676314-91676336 CAAAAGCAAGGCATCAATATAGG + Intronic
1123191736 14:106578581-106578603 CAAGAACCAGAGAACAATGTGGG - Intergenic
1123693552 15:22859693-22859715 CAAGATCCAGACATCAATATGGG - Intronic
1124090213 15:26592330-26592352 CAAGATCACCACATCCATATTGG + Intronic
1126576988 15:50207034-50207056 TAAAATCCAGAAATCCATATGGG + Intronic
1129485655 15:75869536-75869558 CAAGATCAAGATACCAACATTGG + Intronic
1130859234 15:87871892-87871914 CATTATTAAGACATCAATATGGG - Intronic
1131794256 15:95998345-95998367 AAAGCTCCAGACATGAGTATGGG - Intergenic
1133485300 16:6214227-6214249 GAAGAACAAGACATCAATGTAGG - Intronic
1135528327 16:23230988-23231010 CACGATCCAGACACAACTATAGG + Intergenic
1138979964 16:62256165-62256187 CAAGAAACAGACACCAAGATGGG + Intergenic
1141742752 16:85904959-85904981 CCAGACCCAGACATCAACAGTGG - Intronic
1144016254 17:11199276-11199298 CCCGATCCAGACATCAAAAGAGG - Intergenic
1146018754 17:29255984-29256006 CATGATGAAGACATCAATAAAGG + Exonic
1147156612 17:38547385-38547407 CAAGATCCAAACTCCAATCTTGG + Intronic
1151095366 17:71491262-71491284 CAAGATACAAAAATCAAAATGGG - Intergenic
1151163900 17:72188048-72188070 CAATACACAGTCATCAATATAGG - Intergenic
1151521944 17:74636496-74636518 CAATATCCAGACAAGGATATTGG - Intergenic
1151607407 17:75147312-75147334 CAAGTTCCAAAAATCAATAGGGG + Intronic
1153527058 18:6007152-6007174 CAAAAGCCAGACAACAAAATGGG + Intronic
1155937406 18:31767931-31767953 CAAAATGTAGACATCCATATGGG - Intergenic
1156257816 18:35414756-35414778 CAATATCCAGAGTACAATATTGG + Intergenic
1156451502 18:37269034-37269056 CAGGATCCAGAGATCCAGATGGG + Intronic
1158115239 18:53987828-53987850 CAAGATACTGACATTCATATAGG - Intergenic
1164843376 19:31411549-31411571 CCAGATCCAGACACCAAGAGGGG + Intergenic
926126459 2:10275273-10275295 CCAGATCCAGACCCCAATAGAGG + Intergenic
927421208 2:22932741-22932763 AAAGATCCAGAAATCAGCATCGG + Intergenic
928483538 2:31707297-31707319 CAAGAAGCAGACATCAAGATGGG + Intergenic
930875951 2:56216581-56216603 CAGGATACAGTCATCAATATGGG - Intronic
933857512 2:86430050-86430072 AAAGAACCAGACATAAATCTTGG + Intergenic
933949690 2:87317938-87317960 AAAAGTCCAGACATCAATAAGGG + Intergenic
935483065 2:103617220-103617242 CAAGATCAATCCATTAATATTGG + Intergenic
936330502 2:111543659-111543681 AAAAGTCCAGACATCAATAAGGG - Intergenic
937850864 2:126634509-126634531 TAAGATCTAGACATCTTTATAGG + Intergenic
937857805 2:126685298-126685320 CAAGAGCCAGACAGCAATGGGGG - Intronic
942232256 2:173871451-173871473 CAAGCTCTAGACATTACTATTGG - Intergenic
946532126 2:220581942-220581964 CAAAACCAAGACTTCAATATTGG + Intergenic
1170159220 20:13295574-13295596 CAAGACCCAGACACCAAGATGGG + Intronic
1171793677 20:29550131-29550153 CTAGAGCCAGAGATCAATATGGG - Intergenic
1174470296 20:50754685-50754707 CAAAACCCAGAGATGAATATCGG - Intronic
1175137065 20:56832143-56832165 CCAGATCCAGACCTCAAGAGAGG + Intergenic
1177380240 21:20331212-20331234 CAAGATCAAGACGTCAAGAAGGG + Intergenic
1177799143 21:25810304-25810326 CCAGATCCAGACCTCAAGAGAGG + Intergenic
1180476132 22:15709791-15709813 CAAGAACCAGAAATAAATAAGGG + Exonic
951364366 3:21762785-21762807 CCATATCCAGTGATCAATATGGG + Intronic
953872791 3:46642028-46642050 CAAGAAACAGACATCAAAATGGG + Intergenic
955555230 3:60129773-60129795 TAAGATCCAGAATTCAATAATGG - Intronic
957009477 3:74987018-74987040 CAAAATGAAGACATTAATATTGG - Intergenic
959782411 3:110251222-110251244 GAAGATGCAGCCATCAATTTTGG - Intergenic
960160855 3:114349453-114349475 CAGGATTCAGTCATCAAGATGGG - Intronic
961647262 3:128399301-128399323 CAACATTAAGACATCAAAATGGG + Intronic
963359081 3:144247339-144247361 CAATATCCAGAAACCAATATCGG + Intergenic
963787019 3:149545254-149545276 CAAAATCCAGACATCCAGAAGGG + Intronic
967205660 3:187118525-187118547 CAAGATACAGAAACCAAGATGGG + Intergenic
971521098 4:27551338-27551360 CAAAATACAGACACAAATATAGG - Intergenic
974118944 4:57614552-57614574 CAAGATAAAGAAAACAATATTGG - Intergenic
977412651 4:96687929-96687951 CAATATTCAGAAATGAATATTGG + Intergenic
978538992 4:109795424-109795446 AAACATCCAGACATTAATACAGG + Intronic
979404761 4:120295994-120296016 TAAGATACAAACATCAATTTTGG + Intergenic
979406102 4:120312226-120312248 CAAGAACCAGACATTACTAAGGG - Intergenic
979503777 4:121469742-121469764 CAAGATCCAGATTGCTATATAGG - Intergenic
979901690 4:126228038-126228060 CAGGATCCAGTCCTCAATATGGG - Intergenic
980634821 4:135488191-135488213 CAAGAACCAGACAACAAAACTGG + Intergenic
980821295 4:138020868-138020890 CAAGAGTCACACATCAATAATGG + Intergenic
981798521 4:148628503-148628525 CAAGATGCAGACCTCATTAAAGG + Intergenic
982843104 4:160217738-160217760 CAACATACAGAAATCAATAAAGG - Intergenic
983138793 4:164122350-164122372 CAAGCTGCAGACATAGATATTGG + Intronic
984541534 4:181042893-181042915 AAAGATGCAGACATAAAGATTGG - Intergenic
985237110 4:187887405-187887427 CAAGATCCTGATTTCAATTTTGG + Intergenic
991676003 5:69090684-69090706 CCAGATCCAGACCTCAAGACAGG + Intergenic
993940643 5:94054185-94054207 CAAAATGAAGACACCAATATTGG + Intronic
994163195 5:96579935-96579957 ATAGATCCAGACATCAACTTAGG - Intronic
997756242 5:136402032-136402054 CAAGATGAAAACATAAATATGGG + Intergenic
998664886 5:144285524-144285546 TATGCTCCAGATATCAATATGGG + Intronic
1000844101 5:166257598-166257620 CAAGATGAATACATTAATATTGG - Intergenic
1001214518 5:169843102-169843124 CAATATCCAGACATCCATTTTGG - Intronic
1004304251 6:14486304-14486326 CAAGCTCCAGCCAGCCATATTGG + Intergenic
1006737252 6:36283136-36283158 CAACACTAAGACATCAATATTGG + Intronic
1008828771 6:55732216-55732238 AGAGATTCAGACATCAAAATGGG - Intergenic
1009273080 6:61639956-61639978 CAAGGTCCACACATCACTTTTGG - Intergenic
1009318852 6:62259263-62259285 TATGATCCTGACATAAATATTGG - Intronic
1010416643 6:75619159-75619181 AAAGATCCAAAAATAAATATTGG - Intronic
1010651510 6:78460734-78460756 CAAGAATAAGACATCAAGATAGG + Intergenic
1010791891 6:80074860-80074882 CAAGACCCAGGTATCACTATAGG - Intergenic
1012948926 6:105496635-105496657 CAAGACCCTGCCATCAAAATGGG - Intergenic
1013176163 6:107678846-107678868 CTAGATTCAGACATAATTATAGG - Intergenic
1013815757 6:114095439-114095461 CAAGATGCTCACATGAATATGGG + Intronic
1015558876 6:134493080-134493102 CAAGACCAAGAAATCATTATAGG - Intergenic
1015879765 6:137859989-137860011 AAACTTCCAGACATTAATATGGG + Intergenic
1016168492 6:140977619-140977641 GAACATCCAGACATCATAATTGG + Intergenic
1016257095 6:142120386-142120408 GAAGAACCAGAGATCAATGTTGG + Intergenic
1017565973 6:155686983-155687005 CAAGATCTAGAAATAAATAATGG + Intergenic
1024528718 7:50372573-50372595 CAATATCCACAGATCACTATGGG - Intronic
1026082591 7:67235350-67235372 CATGATCCATCCATCAACATGGG - Intronic
1026694476 7:72578652-72578674 CATGATCCATCCATCAACATGGG + Intronic
1027373180 7:77529106-77529128 CAAGACCCAGAAATCATTAACGG + Intergenic
1029013503 7:97288281-97288303 CAAGATCAAGACACCAGCATTGG - Intergenic
1032020969 7:128406947-128406969 CAAGATCCAGATTTCTACATGGG + Intronic
1032434899 7:131892383-131892405 AAAGATCCACACATGGATATAGG + Intergenic
1033436003 7:141334148-141334170 GAAGCTCCAGAAATCAATACTGG - Intronic
1034336665 7:150328260-150328282 CAAAATCCCTACTTCAATATGGG + Intronic
1037656411 8:20887912-20887934 CATAATGCAGACATCATTATCGG - Intergenic
1038679899 8:29657097-29657119 CAAGATAAAGACATCTAAATAGG - Intergenic
1039341791 8:36658541-36658563 CAGGATCCAGAGAGCAGTATAGG - Intergenic
1044972155 8:97630220-97630242 CAAGTTCCAGGCAGCAAGATGGG - Intergenic
1047016944 8:120733785-120733807 CAAGATCCAGTAATAACTATAGG + Intronic
1047588828 8:126304253-126304275 CAAGAAGCAGACATCAAGGTGGG + Intergenic
1050067109 9:1771662-1771684 CAACATGCAGACATCAAACTAGG - Intergenic
1050734123 9:8743875-8743897 CAAAATCCATACATCGACATAGG + Intronic
1050897009 9:10896170-10896192 CAAGATCCAGACACCTCTCTTGG + Intergenic
1051781413 9:20692424-20692446 CAAGATCCGGACATAAACAACGG - Intronic
1053792617 9:41697540-41697562 CTAGAGCCAGAGATCAATATGGG + Intergenic
1054181031 9:61909561-61909583 CTAGAGCCAGAGATCAATATGGG + Intergenic
1054472334 9:65548428-65548450 CTAGAGCCAGAGATCAATATGGG - Intergenic
1054656560 9:67671581-67671603 CTAGAGCCAGAGATCAATATGGG - Intergenic
1058267116 9:102915295-102915317 CAAGAACCAGAAATCAATTGAGG - Intergenic
1060686407 9:125617635-125617657 ACAGCTACAGACATCAATATGGG + Intronic
1188816004 X:34715091-34715113 TAAGCTCCAGACATTGATATTGG + Intergenic
1188884084 X:35528491-35528513 CAAGATCAAGCTATCAATACTGG - Intergenic
1189220196 X:39365150-39365172 CAAGATCCTGTCACCAATCTGGG - Intergenic
1190462411 X:50691590-50691612 CATTATCTAGACAGCAATATAGG + Intronic
1193987223 X:88258571-88258593 CAGGATAAACACATCAATATAGG - Intergenic
1197392302 X:125882939-125882961 CAAAATGCAGACAGTAATATGGG + Intergenic
1197399790 X:125975777-125975799 CAAGATCCAGAAATTCTTATAGG - Intergenic
1198198966 X:134395705-134395727 CAAGATCTAGAGATCAAAAAGGG - Intronic
1199312643 X:146339344-146339366 CAAGATCTAGGCATAAGTATAGG - Intergenic