ID: 1123707282

View in Genome Browser
Species Human (GRCh38)
Location 15:22959522-22959544
Sequence CCGGGCAGTCCCGCCTGCTC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 197
Summary {0: 1, 1: 1, 2: 2, 3: 18, 4: 175}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1123707271_1123707282 19 Left 1123707271 15:22959480-22959502 CCGTGGCTTGCCTCACGTGCCTC 0: 1
1: 0
2: 0
3: 21
4: 159
Right 1123707282 15:22959522-22959544 CCGGGCAGTCCCGCCTGCTCAGG 0: 1
1: 1
2: 2
3: 18
4: 175
1123707275_1123707282 0 Left 1123707275 15:22959499-22959521 CCTCAGTGGCGTGGCCCGCATGG 0: 1
1: 0
2: 0
3: 12
4: 99
Right 1123707282 15:22959522-22959544 CCGGGCAGTCCCGCCTGCTCAGG 0: 1
1: 1
2: 2
3: 18
4: 175
1123707268_1123707282 27 Left 1123707268 15:22959472-22959494 CCGCAGCCCCGTGGCTTGCCTCA 0: 1
1: 0
2: 0
3: 24
4: 239
Right 1123707282 15:22959522-22959544 CCGGGCAGTCCCGCCTGCTCAGG 0: 1
1: 1
2: 2
3: 18
4: 175
1123707270_1123707282 20 Left 1123707270 15:22959479-22959501 CCCGTGGCTTGCCTCACGTGCCT 0: 1
1: 0
2: 0
3: 8
4: 112
Right 1123707282 15:22959522-22959544 CCGGGCAGTCCCGCCTGCTCAGG 0: 1
1: 1
2: 2
3: 18
4: 175
1123707273_1123707282 9 Left 1123707273 15:22959490-22959512 CCTCACGTGCCTCAGTGGCGTGG 0: 1
1: 0
2: 0
3: 2
4: 83
Right 1123707282 15:22959522-22959544 CCGGGCAGTCCCGCCTGCTCAGG 0: 1
1: 1
2: 2
3: 18
4: 175
1123707269_1123707282 21 Left 1123707269 15:22959478-22959500 CCCCGTGGCTTGCCTCACGTGCC 0: 1
1: 0
2: 0
3: 6
4: 79
Right 1123707282 15:22959522-22959544 CCGGGCAGTCCCGCCTGCTCAGG 0: 1
1: 1
2: 2
3: 18
4: 175

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1123707282 Original CRISPR CCGGGCAGTCCCGCCTGCTC AGG Intronic
900094933 1:936428-936450 CCGGTCGGTCCCGCCTTCTAGGG + Intronic
902613073 1:17608414-17608436 CCGCGCAGTCCTCTCTGCTCTGG + Intronic
905944682 1:41891498-41891520 ACGGGCTGCCCCTCCTGCTCTGG + Intronic
906691046 1:47792915-47792937 CAGGGCAGTGCATCCTGCTCTGG - Intronic
909318556 1:74253604-74253626 CCGGCCAGTCCTGCCGGCTCCGG - Intronic
911254504 1:95618649-95618671 CTGGGCAGTTCACCCTGCTCAGG + Intergenic
915528384 1:156489790-156489812 CAGGGCCGGCCTGCCTGCTCTGG - Intronic
918825420 1:189317100-189317122 CAGGGAAGTCCTGCCTACTCAGG + Intergenic
921363906 1:214356081-214356103 CCTGGTAGTCCCAGCTGCTCGGG - Exonic
1067400782 10:45971958-45971980 CTGTGCTGTCCCGCCTGCCCTGG + Intergenic
1070079121 10:73168244-73168266 CCTGGCCCTCCCGCCGGCTCCGG - Exonic
1073511069 10:104042649-104042671 GGGGGCAGTCCCGCCTGCCCCGG - Intronic
1075075316 10:119346558-119346580 CCCGTCAGTGCCGGCTGCTCTGG + Intronic
1076924528 10:133475754-133475776 CCAGGCAGTCCCCCCAGCCCAGG - Intergenic
1076924545 10:133475804-133475826 CCAGGCAGTCCCCCCAGCCCAGG - Intergenic
1076924558 10:133475838-133475860 CCAGGCAGTCCCCCCAGCCCAGG - Intergenic
1076924575 10:133475889-133475911 CCAGGCAGTCCCCCCAGCCCAGG - Intergenic
1077477647 11:2797919-2797941 CCAGGCAGCCCAGGCTGCTCAGG + Intronic
1082066581 11:47905673-47905695 CCTGGCAGTCTCGCCAGCTGCGG - Intergenic
1083621965 11:64053658-64053680 CCAGGCAGTCACACCTGCTGAGG - Intronic
1084192557 11:67505450-67505472 CCGGGCAGCCCCGCCTGCAGCGG + Intronic
1084533886 11:69745720-69745742 CAGGCCAGTGCCGCCTGCTGGGG - Intergenic
1085448555 11:76617103-76617125 CAGGGCAGTCCCTCCCGCTATGG + Intergenic
1088817511 11:113431910-113431932 CCAGGCAGGCCACCCTGCTCAGG + Intronic
1090194086 11:124800205-124800227 CCGGGCAGTGCGGCGGGCTCGGG - Exonic
1094405363 12:30110711-30110733 CCGGCCGGCCCCGCCTGCCCCGG - Intergenic
1094523990 12:31219764-31219786 CCGGGGAGGCCGGCCTGCACAGG - Intergenic
1094655071 12:32411848-32411870 GCCTGCAGTCCCGGCTGCTCGGG + Intronic
1098109866 12:67110987-67111009 CAGGGCAGTCCTGCCTGCTAAGG + Intergenic
1105029800 12:132874546-132874568 CTGGGCAGTCCCGCCTGTTCCGG - Intronic
1105029816 12:132874599-132874621 CTGGGCAGTCCCGCCTGTTCTGG - Intronic
1105029834 12:132874652-132874674 CCGGGCAGTCCCGCCTGTTCCGG - Intronic
1105029851 12:132874705-132874727 CCGGGCCTTCCTGCCTGTTCCGG - Intronic
1106243682 13:27928944-27928966 CCGGGCTGTCCTGCCGGCTCTGG - Intergenic
1106466664 13:30019911-30019933 CCGGGCAATTCCCCCTGCCCTGG - Intergenic
1112344167 13:98576752-98576774 CCGGGCAGGCCCGACTGCACCGG + Intronic
1113640828 13:111955564-111955586 CCGGGCTGTCCCCTCCGCTCAGG + Intergenic
1113954069 13:114087510-114087532 CCCCGCAATCCCGCCGGCTCTGG - Intronic
1113990237 14:16022945-16022967 CTGGGCAGCCCTGACTGCTCTGG + Intergenic
1117452473 14:55865150-55865172 CCAGGCAGGGCCGCCAGCTCGGG - Intergenic
1117760232 14:59019295-59019317 CAGGGCAGTCCTGCCTGCCCAGG + Intergenic
1122205788 14:100147322-100147344 CCCGGCAGACCCCACTGCTCGGG + Intronic
1122539567 14:102490397-102490419 CCTGGCAGTCCTGCCTGCTGGGG - Intronic
1122623211 14:103071326-103071348 CCGGGCAGCGCCGCCAGCCCTGG - Intergenic
1122892442 14:104739036-104739058 CCGGGCACTCACACCAGCTCTGG + Intronic
1122989164 14:105228729-105228751 CCGGGAGGTGGCGCCTGCTCTGG + Intronic
1123707282 15:22959522-22959544 CCGGGCAGTCCCGCCTGCTCAGG + Intronic
1124931646 15:34125606-34125628 CTGGGCAGTCCCTGCTACTCAGG + Intergenic
1127452701 15:59132145-59132167 TCAGGCAGTCCTGCCTGCCCAGG - Intergenic
1129339586 15:74876468-74876490 CAAGGCAGTCCTGCCTGCTCTGG + Intergenic
1129884383 15:79028413-79028435 CCTGGCAATCCCGCTGGCTCAGG + Intronic
1129886822 15:79044047-79044069 CTGGGCAGTCATGCCTGCTCAGG + Intronic
1130524285 15:84690490-84690512 GCCTGCAGTCCCACCTGCTCAGG + Intronic
1131036087 15:89222852-89222874 CCAGGCATTGCAGCCTGCTCTGG - Intergenic
1132462545 16:62583-62605 CCGGTGAGGTCCGCCTGCTCCGG + Exonic
1132770436 16:1559218-1559240 CAGGGAATTCCTGCCTGCTCTGG + Intronic
1133008687 16:2898303-2898325 CCAGGCACTCCCACCGGCTCTGG - Intronic
1133222376 16:4324248-4324270 CCAGGAAGTGCCGCCTGCCCTGG + Intronic
1134093245 16:11402659-11402681 CTGGGCTCTCCAGCCTGCTCAGG - Intronic
1134678148 16:16104889-16104911 CCGGGCAGCCCCGCCAGCCCGGG - Intronic
1136022718 16:27450142-27450164 CGGGGCCGTCCCGCCTGCAGAGG + Exonic
1137566542 16:49536565-49536587 TCTGGCAGTCCCAGCTGCTCAGG - Intronic
1139683345 16:68582330-68582352 CCCTGCAGTCCCAGCTGCTCAGG + Intergenic
1140372648 16:74421486-74421508 CCGGGGATGCCTGCCTGCTCCGG + Intronic
1141232481 16:82182153-82182175 CCAGGGAGTCCCACCAGCTCAGG - Intergenic
1142214417 16:88823721-88823743 CCGGGCATTGCCGCCTGCGAGGG - Intronic
1142214430 16:88823763-88823785 CCGGGCATTGCCGCCTGCGAGGG - Intronic
1142222976 16:88864458-88864480 CCGGGCAGGACCCCATGCTCCGG - Intronic
1144863636 17:18321225-18321247 CAGGGCAGTCCCTGCTGCTCTGG + Intronic
1144954393 17:19011796-19011818 CCTGGCAGTCCCCCCTACCCTGG - Intronic
1145796142 17:27656388-27656410 CCGCGCATTTCAGCCTGCTCTGG + Intergenic
1145810593 17:27761711-27761733 CCGCGCATTTCAGCCTGCTCTGG + Intronic
1147250720 17:39151348-39151370 CCCGCCAGTCCTACCTGCTCCGG + Exonic
1147645022 17:42028181-42028203 CCGGGCGGCCCCGGCTCCTCCGG + Exonic
1147648807 17:42050482-42050504 CCCGCCCGTCCCGCCCGCTCCGG + Intronic
1149347201 17:55751006-55751028 CCGGGCTGCCCCGGCTGCCCCGG - Exonic
1152085323 17:78214419-78214441 CCGGGCAGTCTCACCCGCTCCGG - Exonic
1152235611 17:79136752-79136774 CCTGGCACTGCCGCCTGCCCTGG - Intronic
1152613600 17:81328082-81328104 CCAGGCAGCCCCGGCTGCTTCGG - Intronic
1153328203 18:3843593-3843615 CGGGGCAGCCCAGCATGCTCTGG + Intronic
1154057257 18:11023909-11023931 CCGGCCAGTCCTGCCGGCCCCGG - Intronic
1158525319 18:58207927-58207949 CTGTGTAGTCCCACCTGCTCAGG + Intronic
1160765231 19:804629-804651 CCGGGCAGAGCCCCGTGCTCAGG + Exonic
1160817617 19:1043373-1043395 ACCCGCTGTCCCGCCTGCTCTGG + Exonic
1160947775 19:1651707-1651729 CCGGGCCGCACCGCCTGCACCGG - Intronic
1160993486 19:1871326-1871348 CCGTCCAGTCCCTCCTGCTACGG - Intergenic
1161155859 19:2731684-2731706 CCGGGCATGCCCGCCTGGGCTGG - Intronic
1161169762 19:2806957-2806979 CCCAGAAGTCCCGCCTGCTGGGG + Exonic
1161207721 19:3050432-3050454 CCGTGCAGTCCCAGCTACTCAGG - Intergenic
1163158057 19:15449700-15449722 CCGGGGGGTCCCGCCTGGCCCGG + Intronic
1163262319 19:16198477-16198499 CGAGCCAGTCCCGCCTTCTCAGG + Intronic
1163511241 19:17736336-17736358 CCAGGCAGTCCCAGCTACTCAGG - Intergenic
1164920973 19:32088579-32088601 CCCAGCAGTCCTGCCTGCTCAGG - Intergenic
1166719109 19:44987434-44987456 CCGGGAAGTCCCGCCCACACCGG - Intronic
1166983407 19:46645385-46645407 CCTGTTAGTCCCGGCTGCTCAGG + Intergenic
926437681 2:12854333-12854355 CCGGCCAGTGCCGCCAGCCCAGG - Intergenic
927809415 2:26173237-26173259 CCGGGCTGGCCGGCCTGCGCTGG + Exonic
933139794 2:78779092-78779114 CCGGCCAGCCCCGCCGGCCCCGG + Intergenic
933277783 2:80302189-80302211 CCGGCCCGTCCCGGCTGCCCAGG + Exonic
936239056 2:110771348-110771370 CATGGCTGTCCTGCCTGCTCAGG + Intronic
938289239 2:130140739-130140761 CAGGGCAGTCCCGCAAACTCAGG + Intronic
938467287 2:131532199-131532221 CAGGGCAGTCCCGCAAACTCAGG - Intronic
942148015 2:173044956-173044978 CCAGGCAGGCCAACCTGCTCTGG + Intronic
946376495 2:219312918-219312940 CCGGCCAGCCCCGCCGGCCCCGG + Intergenic
1168819228 20:761980-762002 CAGGCCAGCCCTGCCTGCTCAGG - Intronic
1169288846 20:4331783-4331805 CAGGGCACTCCCCTCTGCTCAGG - Intergenic
1171944827 20:31367274-31367296 CTGGGCAGTCCCAGCTACTCAGG + Intergenic
1174500588 20:50981247-50981269 CCGAGGAGGCCCTCCTGCTCTGG - Intergenic
1174861719 20:54097591-54097613 CCTCGCAGTGCCGGCTGCTCAGG + Intergenic
1175715627 20:61252810-61252832 CCGGGGAGCTCCGCCTGCACCGG + Intronic
1175869107 20:62199135-62199157 CCGGGAAGTCCTCACTGCTCCGG + Exonic
1176053501 20:63133166-63133188 CCGGCCAGTTCCACCAGCTCAGG - Intergenic
1176063642 20:63183043-63183065 CCGGGCATTCCAGCCTGGTCCGG + Intergenic
1176102446 20:63370607-63370629 CTGAGCTGTCCCTCCTGCTCAGG - Intronic
1176273069 20:64246566-64246588 CCAGCCAGTCCCACCTGCTCTGG - Intergenic
1176366493 21:6036046-6036068 CCTTGCTGTCCAGCCTGCTCGGG + Intergenic
1177145714 21:17404743-17404765 ACGGGCAGTCCAGGCTACTCAGG + Intergenic
1177496917 21:21902520-21902542 CCGGTCAGCCCTGCCTGCCCCGG + Intergenic
1179757024 21:43502499-43502521 CCTTGCTGTCCAGCCTGCTCGGG - Intergenic
1180317035 22:11284581-11284603 CTGGGCAGCCCTGACTGCTCTGG - Intergenic
1181573853 22:23781892-23781914 CAGGGCAGTCCAGCCTGCAGGGG + Intronic
1181680852 22:24495017-24495039 CCGCGCAGTCCCGCCTGTGGAGG + Intronic
1181737767 22:24895151-24895173 CCCAGCAGTCCTTCCTGCTCTGG + Intronic
1182421553 22:30250989-30251011 CCGGGCACCCCCGGCTGCCCAGG + Intergenic
1183743587 22:39681072-39681094 AAGGACAGACCCGCCTGCTCAGG - Intronic
950590855 3:13935009-13935031 CCGGCCAGTTCCTCCTTCTCAGG - Intergenic
957556312 3:81767649-81767671 CCGGTCTGTCCCGCCGGCCCCGG - Intergenic
965576404 3:170222490-170222512 CCGCGCGGTTCCGGCTGCTCCGG + Exonic
969330539 4:6471644-6471666 CCTGGGAGGCCCGCCTGCCCGGG - Intronic
969411860 4:7033705-7033727 GCGGGCAGCCGCACCTGCTCTGG - Intergenic
970448913 4:16148086-16148108 CTGGGCTGTCCCGCCAGCTTCGG + Intergenic
974017833 4:56665078-56665100 ACGTGTAGTCCCGCCTACTCAGG - Intronic
977294301 4:95193859-95193881 CCGGCCTCTCCCACCTGCTCGGG + Intronic
980774479 4:137421119-137421141 CCGGCCGGCCCCGCCTGCCCGGG + Intergenic
981429765 4:144645796-144645818 CCGGGCAGTCCCGGAATCTCCGG + Intergenic
982707172 4:158723151-158723173 CCGGGAACCCCCGCCTCCTCGGG + Intronic
982734688 4:158993240-158993262 CCGGGTAGTCCCAGCTCCTCAGG + Intronic
985445399 4:190018816-190018838 CCGGGCAGCCCTGGCTTCTCTGG + Intergenic
985593570 5:777783-777805 GCGGGCAGCTCCGCCTGCTGCGG - Intergenic
989195526 5:38712812-38712834 ACTGGCATTGCCGCCTGCTCAGG + Intergenic
997585265 5:135039900-135039922 GCGCGCAGTCCCGCCGGCTAGGG + Intronic
1000110900 5:158107324-158107346 CCTGGCAGTGCTGCTTGCTCAGG - Intergenic
1002884758 6:1283280-1283302 GCGGGCAGTCCAGCCTGCTATGG - Intergenic
1003072608 6:2956927-2956949 GGGAGCAGTCCTGCCTGCTCAGG + Intronic
1006717270 6:36128696-36128718 CCGGGCAGTCCTGCAGCCTCAGG - Intronic
1007525290 6:42487214-42487236 CCAGTCAGACCCTCCTGCTCAGG + Intergenic
1007633498 6:43285229-43285251 CCGGGGCGTCCCGCCGGCCCGGG + Exonic
1010244840 6:73653615-73653637 CCGCTCAGTCCCGCCTGCCTCGG - Intronic
1013504085 6:110781717-110781739 CCTGGTAGTCCCACCTACTCAGG + Intronic
1014632539 6:123803929-123803951 GCGGGCAGTGCCGCCTGCGGAGG - Intergenic
1017298971 6:152834443-152834465 CCGGCCAGTCCTGCCGGCCCCGG + Intergenic
1018775635 6:167012776-167012798 CAGGACAGTCCCCCCTTCTCTGG - Intronic
1018861426 6:167713116-167713138 CCAGGCAGTCCCCCAGGCTCAGG + Intergenic
1018980541 6:168598683-168598705 GCTGGCAGGCCCTCCTGCTCCGG + Intronic
1019161926 6:170074704-170074726 CCAGGCTGTCCCTCCTTCTCAGG - Intergenic
1019289884 7:245282-245304 CTGGGGATTCCCGCCAGCTCTGG + Intronic
1019343290 7:518430-518452 CGGCGCAGTCCCGCCCGCCCGGG - Intronic
1019729792 7:2623564-2623586 CCTGGCAGGGCCGCCTCCTCCGG - Intergenic
1022440001 7:30425523-30425545 CCTGATAGTCCCGCCTGCGCAGG + Exonic
1024049391 7:45609282-45609304 CCTGGGAGTCCCTCCTGCACAGG - Intronic
1029422677 7:100479222-100479244 CCAGGAAGTCCTGCCTCCTCGGG + Exonic
1029788557 7:102818602-102818624 TCGGACAGTCCCTACTGCTCAGG - Intronic
1032262362 7:130347594-130347616 CCTGCGAGTCCTGCCTGCTCAGG + Intronic
1034988784 7:155534530-155534552 CCGGTCAGTCCCACATGCTAAGG - Intergenic
1036768711 8:11564674-11564696 CCAGGGAGTCCCGCGTGGTCTGG + Intergenic
1036932736 8:12972288-12972310 CCGGCCAGCCCCGCCTCCACGGG - Intronic
1037305298 8:17497514-17497536 CCGGGCAGAGCCGGCTGCACAGG - Intronic
1039960807 8:42246159-42246181 CCCTGCAGTCCCAGCTGCTCAGG - Intergenic
1040021323 8:42743943-42743965 CAGGGCAGCCCGGCCTGCTGTGG + Intergenic
1040995027 8:53392452-53392474 CCGGGGAGCCCAGCCTGCTTAGG + Intergenic
1042278755 8:67031883-67031905 CCAGGTAGTCCCAGCTGCTCAGG + Intronic
1044833663 8:96275278-96275300 CCCTGCAGTCCCAGCTGCTCAGG - Intronic
1047707225 8:127511954-127511976 CCTGGTAGTCCCGGCTACTCGGG - Intergenic
1049393175 8:142382441-142382463 CCCGCCAGTCCCTTCTGCTCGGG + Intronic
1053560714 9:39191101-39191123 CTGGGCAGTCCCAGCTACTCAGG + Intronic
1053824814 9:42011351-42011373 CTGGGCAGTCCCAGCTACTCAGG + Intronic
1053890963 9:42692653-42692675 CCGGGGAGAGCCGCTTGCTCAGG - Intergenic
1054136405 9:61427854-61427876 CTGGGCAGTCCCAGCTACTCAGG - Intergenic
1054220736 9:62409106-62409128 CCGGGGAGAGCCGCTTGCTCAGG + Intergenic
1054229978 9:62500066-62500088 CCGGGGAGAGCCGCTTGCTCAGG - Intergenic
1054605758 9:67176012-67176034 CTGGGCAGTCCCAGCTACTCAGG - Intergenic
1056794441 9:89647953-89647975 CAGGACAGTCCATCCTGCTCTGG - Intergenic
1057440496 9:95079604-95079626 CCGAGCAATGCCGCCTGCTCCGG + Intronic
1058851271 9:109013650-109013672 CCGCGCAGTCCAGCCTGGTGTGG + Intergenic
1059967468 9:119629428-119629450 AAGGGCAGTCCTGCCTGTTCAGG - Intergenic
1060128711 9:121075030-121075052 CCGAGCAGTCCCGCAGGCTGAGG - Exonic
1060161663 9:121370232-121370254 CAGGGCATTCCCGGCGGCTCCGG - Intronic
1060811474 9:126613397-126613419 CCGGGCGGCGGCGCCTGCTCGGG - Intergenic
1060918802 9:127406352-127406374 CCGGGCAGTCCTGCCTAAGCGGG - Intronic
1061180313 9:129021622-129021644 CCGGGCAGTCCCTTCATCTCTGG + Intronic
1062059698 9:134488466-134488488 CAGGGCAGCCGCCCCTGCTCGGG + Intergenic
1189383467 X:40518342-40518364 CATAGCAGTCTCGCCTGCTCTGG + Intergenic
1192270853 X:69577963-69577985 CCTGGCAGCCCTGCCTGCTTTGG + Intergenic
1194719187 X:97320588-97320610 GCCTGCAGTCCCGGCTGCTCAGG + Intronic
1195346374 X:103954356-103954378 CAGGGCAGTCTTGCGTGCTCTGG + Intronic
1198404613 X:136300268-136300290 CCAGGCAGGCCCGACTGCACAGG + Intergenic
1201604535 Y:15770895-15770917 CCGGGCAGTCCCTTCATCTCTGG - Intergenic