ID: 1123707462

View in Genome Browser
Species Human (GRCh38)
Location 15:22960308-22960330
Sequence CCTCACAGGTCCCACGCAGT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 113
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 102}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1123707453_1123707462 19 Left 1123707453 15:22960266-22960288 CCAGCATCAACCTCACCAGCTTC 0: 1
1: 0
2: 1
3: 36
4: 460
Right 1123707462 15:22960308-22960330 CCTCACAGGTCCCACGCAGTGGG 0: 1
1: 0
2: 0
3: 10
4: 102
1123707455_1123707462 4 Left 1123707455 15:22960281-22960303 CCAGCTTCCTCCACATGCACCAA 0: 1
1: 0
2: 3
3: 17
4: 266
Right 1123707462 15:22960308-22960330 CCTCACAGGTCCCACGCAGTGGG 0: 1
1: 0
2: 0
3: 10
4: 102
1123707454_1123707462 9 Left 1123707454 15:22960276-22960298 CCTCACCAGCTTCCTCCACATGC 0: 1
1: 0
2: 1
3: 43
4: 438
Right 1123707462 15:22960308-22960330 CCTCACAGGTCCCACGCAGTGGG 0: 1
1: 0
2: 0
3: 10
4: 102
1123707456_1123707462 -3 Left 1123707456 15:22960288-22960310 CCTCCACATGCACCAAGACACCT 0: 1
1: 0
2: 0
3: 27
4: 230
Right 1123707462 15:22960308-22960330 CCTCACAGGTCCCACGCAGTGGG 0: 1
1: 0
2: 0
3: 10
4: 102
1123707457_1123707462 -6 Left 1123707457 15:22960291-22960313 CCACATGCACCAAGACACCTCAC 0: 1
1: 0
2: 0
3: 20
4: 237
Right 1123707462 15:22960308-22960330 CCTCACAGGTCCCACGCAGTGGG 0: 1
1: 0
2: 0
3: 10
4: 102

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1123707462 Original CRISPR CCTCACAGGTCCCACGCAGT GGG Intronic
902489337 1:16769630-16769652 CCTCTCATGGCCCACACAGTAGG + Intronic
904897220 1:33826006-33826028 CCTCTCAGAGCCCACCCAGTAGG - Intronic
907890437 1:58631567-58631589 CCTCACAGGTCCCTCTCTTTTGG + Intergenic
911527654 1:99005113-99005135 CCTCACAGGGCGGACGCTGTGGG + Intergenic
914244876 1:145878177-145878199 CATCACAGGTACCAGGCACTTGG - Intronic
916868591 1:168887650-168887672 CCACACAGATCCCACACACTTGG - Intergenic
917139211 1:171818036-171818058 CCTCACGGGTAACAGGCAGTGGG + Intergenic
923531101 1:234812895-234812917 CCTCTCATGGCCCACACAGTAGG - Intergenic
1068533027 10:58210230-58210252 TCACCCAGCTCCCACGCAGTTGG + Intronic
1073741613 10:106414378-106414400 TCACTCAGCTCCCACGCAGTTGG - Intergenic
1075745464 10:124724392-124724414 CCTCACAAGGCCCAGGCAGGGGG + Intronic
1076112535 10:127872118-127872140 CCACTCAGCTCCCACGCACTTGG + Intergenic
1080866612 11:36200914-36200936 CCTTCCTGGTCCCACGCAGAAGG + Intronic
1082679604 11:56152256-56152278 CCACACAGCTTTCACGCAGTTGG - Intergenic
1088531208 11:110811772-110811794 ACTCACAGTTCCCACGTGGTTGG + Intergenic
1089692142 11:120193493-120193515 CCGCACAGGCCCCATACAGTGGG - Intergenic
1089764371 11:120752136-120752158 CCTCACTGGTCACAAGAAGTTGG - Intronic
1090445494 11:126761352-126761374 CCTCACAGGCCCCAGCGAGTAGG - Intronic
1090748073 11:129723185-129723207 CCTCTGAGGTCCCAAGCACTGGG - Intergenic
1091591265 12:1844192-1844214 CACCACAGGTCCCACGCTGAAGG - Intronic
1092584963 12:9890286-9890308 CCTCACAGTTCCCACGAGTTGGG + Intronic
1094664013 12:32500243-32500265 CCTCACAGGGCCTATGAAGTAGG - Intronic
1096618738 12:52849175-52849197 CCTCAGAGCTCCCAGGCTGTTGG + Intergenic
1096897760 12:54840822-54840844 CCACCCAGCTCCCACGCATTTGG + Intronic
1102696985 12:114807747-114807769 CCTCACAGGTTCCAGGGATTAGG - Intergenic
1117240668 14:53829349-53829371 TCACCCAGTTCCCACGCAGTTGG - Intergenic
1123707462 15:22960308-22960330 CCTCACAGGTCCCACGCAGTGGG + Intronic
1124628646 15:31325472-31325494 CCTCAGTGGACCCTCGCAGTGGG - Intergenic
1132725245 16:1335599-1335621 GCTCCCAGGGCCCACGCAGTTGG + Intronic
1143918013 17:10309126-10309148 CCACTCAGGGCCCACGCCGTGGG - Intronic
1146521747 17:33530758-33530780 CCTCACAGGTACCAAGGGGTTGG + Intronic
1146723099 17:35137084-35137106 CCTCACCGGGCACACCCAGTCGG - Exonic
1147609770 17:41794570-41794592 CCTCCCTGGCCCCAGGCAGTAGG - Intergenic
1152594400 17:81231409-81231431 ATTCACTGGTCCCACGCAGGTGG + Exonic
1152627016 17:81392538-81392560 CCTCCCATGTCCCTGGCAGTGGG + Intergenic
1155177777 18:23315810-23315832 CCTCCCAGGCCCCAGTCAGTTGG - Intronic
1159279856 18:66271251-66271273 CCTCACAGGTTTCCCTCAGTTGG + Intergenic
1160588281 18:79925180-79925202 CCTCCCAGGTCCCTCGGAATAGG - Intronic
1160624354 18:80192778-80192800 CCTCACAGTCCCCACGCTGTGGG + Intronic
1164445831 19:28316870-28316892 CCTCACAGCACACAGGCAGTTGG - Intergenic
1165524667 19:36343915-36343937 CCTCATAGATCCCACCCATTGGG + Intronic
1166738012 19:45097496-45097518 CCCCACAGCTCCCACCCAGCTGG - Intronic
1167521877 19:49960131-49960153 ACTCACAGGCCACACGGAGTCGG + Exonic
1167523507 19:49970591-49970613 ACTCACAGGCCACACGGAGTCGG - Intergenic
1167609961 19:50502220-50502242 CCTCCCAGCTCCCACCCTGTGGG - Intergenic
1167756559 19:51416660-51416682 ACTCACAGGCCACACGGAGTCGG + Exonic
925578205 2:5382007-5382029 CCACACAGGAGCCACGCAGAAGG + Intergenic
927771474 2:25865886-25865908 CATCTCAGGTCTCATGCAGTTGG - Intronic
936890084 2:117359442-117359464 CCACACAGATCCCACACACTTGG - Intergenic
939476435 2:142693834-142693856 CCACCCAGCTCCCACGCAGTTGG - Intergenic
940387539 2:153090920-153090942 TCACCCAGGTCCTACGCAGTTGG + Intergenic
944602771 2:201320520-201320542 CCACACAGATCCCATGCACTTGG - Intronic
944681948 2:202085255-202085277 CCTCTCAGGTCCCAGGGATTAGG - Intronic
947328964 2:229008317-229008339 TCTCACAGATCCTACGCAGTAGG - Intronic
948746260 2:240096091-240096113 CCCCACAGTTCCCACGCACTTGG - Intergenic
1168941096 20:1712017-1712039 CCACACAGTTCCCACGTACTTGG - Intergenic
1169550027 20:6692984-6693006 CCTCACAGGCCCCGTGCAGCTGG + Intergenic
1172003629 20:31801659-31801681 CCTCACAGCAGCCACGCAGCAGG + Exonic
1172621484 20:36320706-36320728 CCCCAGAGGTCCCAGGCAGGTGG - Intronic
1174059593 20:47823267-47823289 GCTCACAGGTCCCAGGAAGGTGG + Intergenic
1174115378 20:48223327-48223349 TCACACAGGTCCCACCCAATTGG - Intergenic
1177713070 21:24805143-24805165 GCTCACAGGTTCCAGGCATTAGG + Intergenic
1179779788 21:43692042-43692064 CTTAACAGGTCCCAGGCAATTGG - Intronic
1179838927 21:44057804-44057826 CCACCCAGGTCCCACTCACTAGG - Intronic
1181100306 22:20534481-20534503 TCTCACAGGTGCAGCGCAGTGGG - Intronic
1183084933 22:35480918-35480940 CCTCACAGGCCTCACACAGCAGG - Intergenic
950902791 3:16512924-16512946 CCTCCCAGGGCACACGCAGAGGG + Intronic
952027435 3:29099909-29099931 CCACACAGTTCCCACACACTTGG + Intergenic
952535100 3:34300899-34300921 CCTCACAGGACCCACACGGGTGG + Intergenic
956224816 3:66945722-66945744 CCTCAAAGATCCCACGGAGGGGG + Intergenic
957681339 3:83439922-83439944 TCACCCAGTTCCCACGCAGTTGG - Intergenic
961056829 3:123796092-123796114 ACTCACAGGTTCCCTGCAGTAGG + Intronic
961322965 3:126090964-126090986 CCTCTCAGGTCCTAGGCAGCTGG - Intronic
965290633 3:166873862-166873884 CCTCACAGGGCCAAAGCAGGAGG - Intergenic
970422784 4:15920644-15920666 CCTCACATTTCCCATGCATTTGG - Intergenic
973599692 4:52529654-52529676 ATTCACAGGTTCCAAGCAGTAGG - Intergenic
973790302 4:54372098-54372120 CCTCACATGTGCCAGGCACTAGG - Intergenic
974490454 4:62557671-62557693 CCACACAGCTCCCACACACTTGG + Intergenic
977840667 4:101699798-101699820 CCTATCAGGTCCCACGTAATTGG + Intronic
988267289 5:28968069-28968091 CCTCACAGGACACATGCAATGGG - Intergenic
993366072 5:87035522-87035544 TCACACAGCTCCCACACAGTCGG + Intergenic
994023388 5:95053688-95053710 CCTACCAGGTACCAAGCAGTAGG + Intronic
995460638 5:112399468-112399490 CCTTCCAGGTGCCAGGCAGTGGG - Intronic
997209560 5:132069450-132069472 CCTCACAGGCCCCTTGCACTCGG - Intergenic
998175789 5:139901196-139901218 CATCCCAGGTCCCAGGCATTTGG - Intronic
1000237527 5:159376402-159376424 CCACCCAGCTCCCACACAGTTGG - Intergenic
1004533724 6:16478899-16478921 CTGCACAGGTCCCAGGCTGTTGG - Intronic
1006315527 6:33289206-33289228 CCTCTCAGCTGCCACACAGTCGG + Exonic
1006512521 6:34529294-34529316 GCTCACAGGTCCCAGGGAGTGGG + Intronic
1007309084 6:40930898-40930920 CCCCACAGGTCCCAACCAGCTGG - Intergenic
1007985184 6:46200356-46200378 CCTCACTGGTCCCAAGTTGTGGG - Intergenic
1014750101 6:125245715-125245737 CCACCCAGCTCCCACGCAGTTGG + Intronic
1015605943 6:134954756-134954778 CCTGTCAGGCCCCACGCATTTGG - Intergenic
1015803183 6:137080998-137081020 CCTCCCAGGGCCCAGGCAGCTGG + Intergenic
1019978428 7:4603168-4603190 CTTCCCAAGTCCCACGCCGTTGG + Intergenic
1023848940 7:44139902-44139924 CATCCCAGGTCCCCCGCAGGAGG + Intronic
1026845069 7:73694137-73694159 CCTCTCAGGTCACATGCAGCAGG + Intronic
1027954750 7:84863916-84863938 CCTGATAGGTCCCAGGCAGCTGG - Intergenic
1031022432 7:116642776-116642798 CCCCACTGGTCCCACGAAGAGGG - Intergenic
1035159954 7:156943220-156943242 CCTCACTGTTCCCAAGCTGTCGG - Intergenic
1038577451 8:28717284-28717306 CCACACAGTGCCCACTCAGTCGG - Exonic
1040868040 8:52070458-52070480 CCACTCAGCTCCCATGCAGTTGG + Intergenic
1042162046 8:65906179-65906201 ACTCACAGGTCCCAAGGATTAGG - Intergenic
1047634416 8:126744607-126744629 CCACACAGATCCCATGCACTTGG + Intergenic
1056654196 9:88495841-88495863 CCTCACAGTTCCCACCCTGAGGG - Intergenic
1061769184 9:132904650-132904672 CAACACAGGTCCTAGGCAGTGGG - Intronic
1062107067 9:134761524-134761546 CCTCAGAGCTCGCACGCAGTGGG - Intronic
1190882725 X:54504355-54504377 CCTCACAGGTCTGATGTAGTAGG - Intergenic
1191616650 X:63176768-63176790 CCACACAGATCCCACGCACTTGG - Intergenic
1191619647 X:63202155-63202177 CCACACAGATCCCACGCACTTGG + Intergenic
1192930474 X:75800858-75800880 CCTCACTCATCCCATGCAGTTGG - Intergenic
1193549422 X:82872153-82872175 CCTCACAGTTTCCATGCACTTGG + Intergenic
1201956532 Y:19629880-19629902 CCTCACTGCTGCCAAGCAGTTGG + Intergenic