ID: 1123716153

View in Genome Browser
Species Human (GRCh38)
Location 15:23034034-23034056
Sequence AGAGCTCAGTTACCACAAGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 152
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 142}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1123716153_1123716154 -6 Left 1123716153 15:23034034-23034056 CCAGCTTGTGGTAACTGAGCTCT 0: 1
1: 0
2: 0
3: 9
4: 142
Right 1123716154 15:23034051-23034073 AGCTCTTGAAATATCTGAACTGG 0: 1
1: 0
2: 1
3: 11
4: 152

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1123716153 Original CRISPR AGAGCTCAGTTACCACAAGC TGG (reversed) Intronic
902864568 1:19269637-19269659 AGAGCTCCGTTTCCACCTGCCGG + Intergenic
902866791 1:19285072-19285094 AGAGCTCCGTTTCCACCTGCCGG + Exonic
902869841 1:19307368-19307390 AGAGCTCCGTTTCCACCTGCCGG + Exonic
905018026 1:34790983-34791005 AGACAACAGTTACCACAACCTGG - Intronic
905293483 1:36939403-36939425 AGAGCTACGTTGACACAAGCTGG + Intronic
906550211 1:46659378-46659400 AGAGCACAGTAATCCCAAGCAGG - Intronic
908159622 1:61393706-61393728 AGAGCTCTGTTTCCAGAAGAAGG + Intronic
909284798 1:73802196-73802218 AGTCTTCAGTCACCACAAGCAGG + Intergenic
909514111 1:76488201-76488223 AGATCTCACTTACCACAAAGGGG - Intronic
910423776 1:87099454-87099476 AGAGCTCAGTTATCACCAAGGGG + Intronic
913248018 1:116887430-116887452 AGAGCTCATTTATCACCAACGGG - Intergenic
915528806 1:156491647-156491669 GCTGCTCAGTAACCACAAGCAGG - Intronic
915605349 1:156946941-156946963 AGAGATCAGTGACCTCATGCTGG - Exonic
919333558 1:196203572-196203594 AGTGCTCATCTACCAGAAGCTGG + Intergenic
920365513 1:205446352-205446374 AGAGGTAAGTTGCCACCAGCAGG - Intronic
920500896 1:206484911-206484933 AGAGCTCTGTTGGCACATGCTGG - Intronic
921158638 1:212457399-212457421 AGAGCTCATTTACCAACAGGAGG - Intergenic
924199411 1:241643215-241643237 AGAGCTCACTTATCACAAAGGGG - Intronic
1070058344 10:72956408-72956430 AGAGCTCCTTTTCCAAAAGCAGG + Intergenic
1071189934 10:83088703-83088725 AGAGCTCAGTACCCACATGGTGG - Intergenic
1073256072 10:102152154-102152176 AGAGCTCCGCCTCCACAAGCTGG + Exonic
1075473529 10:122712374-122712396 AATGCTCAGTCACCACAGGCAGG - Intergenic
1077291167 11:1794837-1794859 AGAGCTCACTCACCACCAGAGGG - Intergenic
1082771119 11:57208249-57208271 ACAGCTTGGTTACCACTAGCTGG + Intergenic
1085077775 11:73606991-73607013 AGAGCTGAGTTTCCTCCAGCTGG + Intergenic
1085787580 11:79468679-79468701 TGTTCTCAGTTACCACAAGCTGG + Intergenic
1088128269 11:106455678-106455700 GGAGCTCCGTAACCAAAAGCAGG - Intergenic
1096693628 12:53335613-53335635 AGGGGACAGTTACCTCAAGCAGG + Exonic
1101033521 12:100682926-100682948 AGAGCACTGTTACCAAAAGAAGG - Intergenic
1106470708 13:30051822-30051844 ATAACTCAGTGACCACAACCAGG + Intergenic
1106850090 13:33780995-33781017 AGAGCTCACTTACCACCAAAAGG + Intergenic
1110475285 13:75906831-75906853 AGAGATCAGTTACCACTGGGAGG - Intergenic
1111791816 13:92866426-92866448 AGAGTTCAGTTACCAAATCCCGG - Exonic
1118085541 14:62411792-62411814 AGTATTCATTTACCACAAGCAGG + Intergenic
1119262760 14:73247382-73247404 AGAGGTCATTTGCCGCAAGCAGG - Intronic
1122255231 14:100471421-100471443 AGAGAGCACTTACCAAAAGCTGG - Intronic
1123082440 14:105701985-105702007 AGAGCTCAGTTACCAGAAATAGG + Intergenic
1123716153 15:23034034-23034056 AGAGCTCAGTTACCACAAGCTGG - Intronic
1125208076 15:37177755-37177777 AGAGTTCAGCTACCACATGGAGG - Intergenic
1125502115 15:40246329-40246351 AGAGGTCAGTTCCCAGAAGCAGG + Intronic
1131077764 15:89506562-89506584 AAAGCACTGGTACCACAAGCTGG - Intergenic
1132316520 15:100894241-100894263 CCAGCTCAGTGGCCACAAGCAGG - Intronic
1132778322 16:1609357-1609379 AGAGCTCCCTTACCCAAAGCCGG - Intronic
1133747250 16:8696655-8696677 AGAGCTCAGGGACCACAGTCAGG - Intronic
1134610593 16:15605287-15605309 AGGGCTAAGTCACCACAAGTTGG + Intronic
1134662030 16:15991519-15991541 AGAGCTCAGTGTCGCCAAGCAGG + Intronic
1135392299 16:22104061-22104083 AGAGCACTGTTACCAGAAGGGGG + Intronic
1137409841 16:48218938-48218960 AAAGCTCAGTCACAATAAGCAGG + Intronic
1137473947 16:48790373-48790395 AGAGCTCAGTGAAGTCAAGCTGG - Intergenic
1137697304 16:50469734-50469756 AGAGGGCAGATGCCACAAGCTGG + Intergenic
1139973879 16:70793539-70793561 ATAGCACAGCTACCACCAGCTGG + Intronic
1141355520 16:83342102-83342124 AGTGCTCAGTAGCCACATGCAGG - Intronic
1141448376 16:84079053-84079075 AGAACTCAGTTACCACCAGAGGG - Intronic
1145104202 17:20101587-20101609 TGTGCTCAGATACCACAAGGAGG - Intronic
1149291162 17:55218859-55218881 AGATCTCACTTACCACAATAGGG + Intergenic
1150428217 17:65094123-65094145 AGAACTCACTTACCACCAGGGGG + Intergenic
1155633107 18:27918976-27918998 ATAGTTCAGTTACCAAAACCAGG - Intergenic
1157426417 18:47588142-47588164 AGGACTCAGTTATCACAAGAGGG - Intergenic
1162909255 19:13840574-13840596 ACAGCTCAGTGACCACACCCAGG + Intergenic
1164797485 19:31045797-31045819 AGAGCTCAGTTACCAGATCCAGG + Intergenic
1164924215 19:32114424-32114446 ACAGCTCAGTTACCCAAATCAGG - Intergenic
1164924228 19:32114596-32114618 ACAGCTCAGTTACCCAAATCAGG - Intergenic
1166398728 19:42462073-42462095 AGAGCTCAGTCACCAACACCAGG - Intergenic
1166471928 19:43085249-43085271 AGAGGTCAGTGAGCACAGGCAGG - Intronic
1168315209 19:55482018-55482040 AGAGCTCAGGCACCACGGGCGGG - Exonic
925566232 2:5257441-5257463 AGAGCTCATGTACCATGAGCAGG + Intergenic
927094838 2:19739795-19739817 AGAGCCCAGTTCTCACAACCAGG + Intergenic
930902622 2:56526368-56526390 AGAGCTCACTTACCACCAAGGGG + Intergenic
935331371 2:101980111-101980133 AGAGCTCAGTCATCAGAACCCGG + Intergenic
937092696 2:119217128-119217150 AGATCTCAGATACCTCAAGCTGG + Intergenic
937575871 2:123421458-123421480 AGAGCTCAGTTCCCACCTCCTGG + Intergenic
938262112 2:129903665-129903687 AAAGCCCAGGTGCCACAAGCTGG + Intergenic
938364492 2:130724065-130724087 AGAGCTCACTTACCACCAAAAGG - Intergenic
938757772 2:134396722-134396744 AGCGCTCAGTAAATACAAGCTGG - Intronic
943044238 2:182839664-182839686 AAAGCTCATTTACTAGAAGCAGG - Intronic
943969600 2:194386444-194386466 AGAGCTCAGGAGCCACAAGTGGG + Intergenic
948707876 2:239806430-239806452 AGGGCTCAGAGACCAGAAGCAGG - Intergenic
949059522 2:241949037-241949059 GGAGCTCCGTGCCCACAAGCTGG - Intergenic
1169253947 20:4083190-4083212 GGTGCTCCGTTACCACCAGCTGG + Intergenic
1170477909 20:16734732-16734754 AGAGCACAGCTAGCACTAGCTGG - Intronic
1172226630 20:33309730-33309752 AGAGCTGGGTTTCCACAAGGAGG - Exonic
1175755600 20:61527868-61527890 AGAGCTCTGTTCCCAGAACCCGG + Intronic
1176228526 20:64017839-64017861 ATAGCTCAGTTATCAAAATCAGG + Intronic
1178943852 21:36929850-36929872 AGAGCGCTGTTGCCACAAGATGG + Intronic
1180232681 21:46436764-46436786 AGAGCTCAGAAACCTCCAGCCGG - Intronic
1181340911 22:22179155-22179177 ACAGCTGAGTCAGCACAAGCTGG - Intergenic
950429069 3:12940608-12940630 AGAGCTCAGTGCCCAGGAGCTGG + Intronic
954695166 3:52420502-52420524 AGAGTCCAGTTCTCACAAGCAGG + Intronic
956572104 3:70708260-70708282 AGGGCTCAGTAACCACATGTAGG + Intergenic
957772101 3:84707587-84707609 AGAGCTGAGGTTCCCCAAGCAGG - Intergenic
959207601 3:103330769-103330791 ACAGCTCAGTAACAATAAGCTGG + Intergenic
959929761 3:111967075-111967097 ATAGTGCAGTTAGCACAAGCTGG - Intronic
962375140 3:134852867-134852889 AGGGCTCAGATACCCCAACCTGG - Intronic
963443562 3:145373396-145373418 AGAGCTCACTTATCACCAACGGG + Intergenic
963787833 3:149553009-149553031 AGTGTTCAGTTTCCAAAAGCTGG - Intronic
964005681 3:151825091-151825113 AGTGCTGAGCTACCACATGCAGG - Intronic
965562036 3:170071274-170071296 AGAGCTCACTTACCACCAAGGGG - Intronic
968560655 4:1279645-1279667 AGGGCTCAGTCACGGCAAGCTGG - Intergenic
969244230 4:5922163-5922185 AGAGCACAGGGACCACATGCAGG + Intronic
969829824 4:9786287-9786309 GGAGCTCTGTGACCACAGGCTGG - Intronic
970009787 4:11446463-11446485 AGAGCTCAGTTCCCACACACTGG + Intergenic
970563001 4:17301280-17301302 AATGCTCAGTTCCCACATGCAGG + Intergenic
970575487 4:17422934-17422956 AGAGCTCAGTAGCCACATGTGGG - Intergenic
972538626 4:40020271-40020293 AGAGCTCAGGGACCAGTAGCTGG - Intergenic
976988791 4:91337631-91337653 AGAGCTCAGATTCCAGAATCAGG - Intronic
978056951 4:104281866-104281888 AGAGGTCTGTTACCAGAAGATGG + Intergenic
981154449 4:141417350-141417372 AGAGCTCATTTAATACCAGCAGG - Intergenic
985045920 4:185940269-185940291 ACAGCCCAGTTACCACTTGCAGG + Intronic
987323644 5:16792982-16793004 AGAGCCAAGTTGCCACAAGTTGG + Intronic
987704805 5:21448763-21448785 AGAGCTCACATAGCAAAAGCAGG + Intergenic
987725091 5:21687815-21687837 AGAGCTCACTTACCATCACCGGG - Intergenic
988173324 5:27687798-27687820 AGACCACAGTTAGCACAAACGGG + Intergenic
988377347 5:30454306-30454328 AGAACCCAGTGAACACAAGCTGG - Intergenic
990734899 5:58849502-58849524 AGAGCTCTGTTAACACCAGATGG + Intronic
1000594129 5:163194386-163194408 AGAGATCAGATACCAAAAGTGGG - Intergenic
1001627658 5:173149803-173149825 AGAGCTCACTTACCACTAAGGGG + Intronic
1003729724 6:8808029-8808051 AGAGCTCAGTGGCCCCAAGGTGG + Intergenic
1004039745 6:11963761-11963783 AGTGCTCAGATAGGACAAGCAGG + Intergenic
1004197206 6:13515776-13515798 AGAGCTCAGTTGTCAGCAGCAGG + Intergenic
1007904066 6:45441273-45441295 ACAGCTGAGCTACCAGAAGCAGG - Intronic
1008562279 6:52734924-52734946 AGAGCTCACTTATCACCAGGGGG + Intergenic
1009547986 6:65046876-65046898 AGAGCTCACTTATCACAAAGGGG - Intronic
1010046448 6:71449521-71449543 AGAGCTCAGTTATCACCAAGGGG + Intergenic
1014786198 6:125622337-125622359 AAAGCTCAGTAACCACAGGTGGG - Intergenic
1017539422 6:155385164-155385186 AGGGCTCAGTTCTCAGAAGCAGG - Intergenic
1019373277 7:674810-674832 GGTGCCCAGTTACCCCAAGCAGG - Intronic
1019406249 7:885675-885697 AGAGCTGAGTGGCCACAGGCAGG - Intronic
1021994502 7:26166655-26166677 AGTGCTCAATCAACACAAGCTGG + Intronic
1022816983 7:33923346-33923368 AGAGCTTAGTGACCAAAGGCTGG - Intronic
1029697873 7:102226277-102226299 AGAGCTCGGTTTTCAGAAGCAGG + Intronic
1029811269 7:103051500-103051522 AGAGATCAGTGAACACAAGTGGG + Intronic
1031905788 7:127458440-127458462 AGAGCTCACTTACCACCAAGGGG - Intergenic
1034280479 7:149850487-149850509 AAAGCACAGTTACCCCAAGCAGG - Intronic
1038149851 8:24932850-24932872 ACAGCTGAGTGACCACAAACAGG + Intergenic
1049454157 8:142678545-142678567 AGAGCACAGTGACCAGAGGCTGG + Intronic
1050678085 9:8079109-8079131 AGAGCTCACTTACCACCAAGGGG + Intergenic
1051310091 9:15760926-15760948 AGAGATCATTTACCTCAAACAGG + Intronic
1052277889 9:26698998-26699020 AAAGTTCATTTACCACAATCAGG + Intergenic
1055229029 9:74039226-74039248 ACAGTTCAGTTAACACAATCAGG - Intergenic
1056138473 9:83651484-83651506 AGAGGTCAGCTACTACAACCTGG - Intergenic
1057770832 9:97966544-97966566 AGAGCTTAGATACCAGAAGTAGG + Intergenic
1058031698 9:100206636-100206658 ACAGCTCAATTATCACAATCAGG + Intronic
1058465272 9:105220873-105220895 AGAGCTTATTTTCCACCAGCTGG + Intergenic
1058600015 9:106659269-106659291 AGATCTGAGCTTCCACAAGCAGG - Intergenic
1058678922 9:107424918-107424940 AGCGCTCAGTGGCCACATGCAGG + Intergenic
1059196913 9:112379495-112379517 AGAGCTCTGTTCCAAGAAGCTGG + Intergenic
1059396626 9:114038231-114038253 ACAGCTCAGCTTCCAGAAGCTGG - Intronic
1187674790 X:21705229-21705251 AGAGATCAGCTTCCAAAAGCAGG - Intergenic
1188071903 X:25727547-25727569 AGAGCTCAGATTCCAAGAGCTGG + Intergenic
1189344375 X:40229486-40229508 AAAGCTCAGTGACCACAACCTGG - Intergenic
1192834479 X:74784745-74784767 AGACCTCAGTTCCCAGGAGCTGG - Intronic
1199195329 X:145022699-145022721 TGAGCTCATTTTCCACAAGGGGG + Intergenic