ID: 1123716693

View in Genome Browser
Species Human (GRCh38)
Location 15:23039133-23039155
Sequence GAACTGGGTTTCTTGCCGGC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 74
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 64}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1123716693_1123716702 12 Left 1123716693 15:23039133-23039155 CCGGCCGGCAAGAAACCCAGTTC 0: 1
1: 0
2: 0
3: 9
4: 64
Right 1123716702 15:23039168-23039190 TGACGATCAGGACGCGTCCCGGG 0: 1
1: 0
2: 0
3: 3
4: 20
1123716693_1123716697 0 Left 1123716693 15:23039133-23039155 CCGGCCGGCAAGAAACCCAGTTC 0: 1
1: 0
2: 0
3: 9
4: 64
Right 1123716697 15:23039156-23039178 ACGCTTTCCCCGTGACGATCAGG 0: 1
1: 0
2: 0
3: 1
4: 19
1123716693_1123716703 27 Left 1123716693 15:23039133-23039155 CCGGCCGGCAAGAAACCCAGTTC 0: 1
1: 0
2: 0
3: 9
4: 64
Right 1123716703 15:23039183-23039205 GTCCCGGGTAACACGCCCTGTGG 0: 1
1: 0
2: 0
3: 1
4: 44
1123716693_1123716701 11 Left 1123716693 15:23039133-23039155 CCGGCCGGCAAGAAACCCAGTTC 0: 1
1: 0
2: 0
3: 9
4: 64
Right 1123716701 15:23039167-23039189 GTGACGATCAGGACGCGTCCCGG 0: 1
1: 0
2: 0
3: 0
4: 20

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1123716693 Original CRISPR GAACTGGGTTTCTTGCCGGC CGG (reversed) Intronic